Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-185-5p URS00004176D4_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-185: Hsa-mir-185 is a microRNA gene that has been implicated in various cellular processes and diseases, including autism and cancer [PMC3965395]. Studies have shown that hsa-mir-185 is not associated with variations in the TrkB-T1 3′UTR sequence or the region encoding its microRNA, suggesting other regulatory mechanisms may influence its expression [PMC3382618]. In cellular experiments, hsa-mir-185 transfection has been observed to increase the percentage of cells in the G1 phase of the cell cycle, indicating a potential role in cell cycle regulation [PMC2722734]. Furthermore, hsa-mir-185 has been significantly associated with mitochondria in HEK293 cells, which may have implications for cellular energy dynamics and apoptosis [PMC3439422]. In breast cancer, hsa-mir-185 is part of a regulatory profile for Smad7 expression [PMC6310970], while its high expression has been correlated with metastasis and poor clinical outcomes in colorectal cancer [PMC6003936]. Additionally, hsa-mir-185 has been used as a mimic in transfection experiments to study its effects on cellular functions [PMC9064001], and it is considered as part of a prognostic signature comprising multiple plasma miRNAs for disease outcomes [PMC5981448]. Its role as a tumor suppressor miRNA is highlighted by its downregulation alongside other tumor suppressor miRNAs such as hsa-let-7i and hsa-miR-34a [PMC5511817], indicating its potential utility as an epigenetic biomarker for cancer therapy prediction and early detection.

mRNA interactions total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGGAGAGAAAGGCAGUUCCUGA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 22 other species

  1. Bos taurus (domestic cattle) bta-miR-185
  2. Callithrix jacchus cja-miR-185
  3. Canis lupus familiaris cfa-miR-185
  4. Cavia porcellus (domestic guinea pig) cpo-miR-185-5p
  5. Cervus elaphus (red deer) cel-miR-185
  6. Cricetulus griseus cgr-miR-185-5p
  7. Dasypus novemcinctus (nine-banded armadillo) dno-miR-185-5p
  8. Equus caballus (horse) Eca-Mir-185_5p (mature (guide))
  9. Gorilla gorilla gorilla ggo-miR-185 (MIR185)
  10. Gorilla gorilla ggo-miR-185
  11. Loxodonta africana (African savanna elephant) Laf-Mir-185_5p (mature (guide))
  12. Macaca mulatta mml-miR-185-5p
  13. Microcebus murinus (gray mouse lemur) Mmr-Mir-185_5p (mature (guide))
  14. Mus musculus mmu-miR-185-5p
  15. Oryctolagus cuniculus (rabbit) ocu-miR-185-5p
  16. Pan troglodytes ptr-miR-185
  17. Pongo abelii (Sumatran orangutan) Pab-Mir-185_5p (mature (guide))
  18. Pongo pygmaeus ppy-miR-185
  19. Pteropus alecto (black flying fox) pal-miR-185-5p
  20. Rattus norvegicus rno-miR-185-5p
  21. Sus scrofa ssc-miR-185
  22. Tupaia belangeri chinensis tch-miR-185-5p
Relationships

Molecular Relationships

GoFlow Results Publications