Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Gorilla gorilla (western gorilla) ggo-miR-185 URS00004176D4_9593

mRNA interactions total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGGAGAGAAAGGCAGUUCCUGA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 22 other species

  1. Bos taurus (domestic cattle) bta-miR-185
  2. Callithrix jacchus cja-miR-185
  3. Canis lupus familiaris cfa-miR-185
  4. Cavia porcellus (domestic guinea pig) cpo-miR-185-5p
  5. Cervus elaphus (red deer) cel-miR-185
  6. Cricetulus griseus cgr-miR-185-5p
  7. Dasypus novemcinctus (nine-banded armadillo) dno-miR-185-5p
  8. Equus caballus (horse) Eca-Mir-185_5p (mature (guide))
  9. Gorilla gorilla gorilla ggo-miR-185 (MIR185)
  10. Homo sapiens hsa-miR-185-5p
  11. Loxodonta africana (African savanna elephant) Laf-Mir-185_5p (mature (guide))
  12. Macaca mulatta mml-miR-185-5p
  13. Microcebus murinus (gray mouse lemur) Mmr-Mir-185_5p (mature (guide))
  14. Mus musculus mmu-miR-185-5p
  15. Oryctolagus cuniculus (rabbit) ocu-miR-185-5p
  16. Pan troglodytes ptr-miR-185
  17. Pongo abelii (Sumatran orangutan) Pab-Mir-185_5p (mature (guide))
  18. Pongo pygmaeus ppy-miR-185
  19. Pteropus alecto (black flying fox) pal-miR-185-5p
  20. Rattus norvegicus rno-miR-185-5p
  21. Sus scrofa ssc-miR-185
  22. Tupaia belangeri chinensis tch-miR-185-5p
Relationships

Molecular Relationships

Publications