Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Mus musculus (house mouse) mmu-miR-185-5p URS00004176D4_10090

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

mmu-mir-185: mmu-mir-185 is a microRNA that has been identified as a regulator of osteogenic differentiation in mouse mesenchymal stem cells [PMC9075730]. Research utilizing CRISPR-Cas9 technology has shown that the deletion of mmu-mir-185 can promote osteogenic differentiation in primary bone-marrow mesenchymal cells, suggesting its inhibitory role in this process [PMC7404082]. Overexpression studies have further confirmed the regulatory function of mmu-mir-185, where its levels were significantly increased by an expression vector, indicating the potential for targeted manipulation of this microRNA [PMC3708730]. Additionally, mmu-mir-185 has been observed to have a widespread but low expression across various mouse tissues such as the brain, liver, and heart when compared to other microRNAs like let-7-a [PMC1635289]. This ubiquitous expression pattern underscores its potential involvement in multiple biological processes beyond osteogenesis.

mRNA interactions total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGGAGAGAAAGGCAGUUCCUGA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 22 other species

  1. Bos taurus (domestic cattle) bta-miR-185
  2. Callithrix jacchus cja-miR-185
  3. Canis lupus familiaris cfa-miR-185
  4. Cavia porcellus (domestic guinea pig) cpo-miR-185-5p
  5. Cervus elaphus (red deer) cel-miR-185
  6. Cricetulus griseus cgr-miR-185-5p
  7. Dasypus novemcinctus (nine-banded armadillo) dno-miR-185-5p
  8. Equus caballus (horse) Eca-Mir-185_5p (mature (guide))
  9. Gorilla gorilla gorilla ggo-miR-185 (MIR185)
  10. Gorilla gorilla ggo-miR-185
  11. Homo sapiens hsa-miR-185-5p
  12. Loxodonta africana (African savanna elephant) Laf-Mir-185_5p (mature (guide))
  13. Macaca mulatta mml-miR-185-5p
  14. Microcebus murinus (gray mouse lemur) Mmr-Mir-185_5p (mature (guide))
  15. Oryctolagus cuniculus (rabbit) ocu-miR-185-5p
  16. Pan troglodytes ptr-miR-185
  17. Pongo abelii (Sumatran orangutan) Pab-Mir-185_5p (mature (guide))
  18. Pongo pygmaeus ppy-miR-185
  19. Pteropus alecto (black flying fox) pal-miR-185-5p
  20. Rattus norvegicus rno-miR-185-5p
  21. Sus scrofa ssc-miR-185
  22. Tupaia belangeri chinensis tch-miR-185-5p
Relationships

Molecular Relationships

GoFlow Results Publications