v27

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Rattus norvegicus (Norway rat) rno-miR-185-5p URS00004176D4_10116

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

rno-mir-185: rno-mir-185 is a microRNA observed to play a role in the regulatory networks of rats, particularly in the late phase of post-ischemia-reperfusion (IR) injury, where it is involved in loop-motifs linked to inflammatory responses [PMC4424502]. In a study involving polycystic ovary syndrome (PCOS) rats, these animals were divided into three groups, with one group receiving an overexpression of rno-mir-185 via lentivirus [PMC7373746]. The lentivirus containing rno-mir-185 was administered through subcapsular ovarian injections at a specific concentration to ensure overexpression [PMC7373746]. Additionally, cells were transfected with rno-mir-185 mimics or inhibitors to study its effects further [PMC4358957]. The role of rno-mir-185 was also quantified using quantitative PCR with specific primers designed for this microRNA [PMC8093826].

mRNA interactions total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
UGGAGAGAAAGGCAGUUCCUGA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 22 other species

  1. Bos taurus (domestic cattle) bta-miR-185
  2. Callithrix jacchus cja-miR-185
  3. Canis lupus familiaris cfa-miR-185
  4. Cavia porcellus (domestic guinea pig) cpo-miR-185-5p
  5. Cervus elaphus (red deer) cel-miR-185
  6. Cricetulus griseus cgr-miR-185-5p
  7. Dasypus novemcinctus (nine-banded armadillo) dno-miR-185-5p
  8. Equus caballus (horse) Eca-Mir-185_5p (mature (guide))
  9. Gorilla gorilla gorilla ggo-miR-185 (MIR185)
  10. Gorilla gorilla ggo-miR-185
  11. Homo sapiens hsa-miR-185-5p
  12. Loxodonta africana (African savanna elephant) Laf-Mir-185_5p (mature (guide))
  13. Macaca mulatta mml-miR-185-5p
  14. Microcebus murinus (gray mouse lemur) Mmr-Mir-185_5p (mature (guide))
  15. Mus musculus mmu-miR-185-5p
  16. Oryctolagus cuniculus (rabbit) ocu-miR-185-5p
  17. Pan troglodytes ptr-miR-185
  18. Pongo abelii (Sumatran orangutan) Pab-Mir-185_5p (mature (guide))
  19. Pongo pygmaeus ppy-miR-185
  20. Pteropus alecto (black flying fox) pal-miR-185-5p
  21. Sus scrofa ssc-miR-185
  22. Tupaia belangeri chinensis tch-miR-185-5p
 Relationships

Molecular Relationships

 Publications