Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Rattus norvegicus (Norway rat) rno-miR-185-5p URS00004176D4_10116

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

rno-mir-185: Rno-mir-185 is a microRNA that has been studied in various contexts. In a study on polycystic ovary syndrome (PCOS) in rats, the rats were divided into different groups, including a PCOS + rno-mir-185 group, where the rats were infected with rno-mir-185 overexpressing lentivirus [PMC7373746]. Lentivirus overexpressing rno-mir-185 was injected into the ovaries of PCOS rats [PMC7373746]. In another study on ischemia-reperfusion (IR) injury, rno-mir-185 was found to be one of the miRNA-hubs observed at the late phase post-IR injury [PMC4424502]. It was also found that rno-mir-185 participates in four different loop motifs in the late phase of post-IR injury, which are linked to inflammatory responses [PMC4424502]. To analyze the expression of rno-mir-185, quantitative PCR was performed using specific primers and SYBR Green Master Mix [PMC8093826]. Overall, these studies highlight the involvement and potential role of rno-mir-185 in PCOS and IR injury.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGGAGAGAAAGGCAGUUCCUGA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 18 other species

  1. Bos taurus (cattle) bta-miR-185
  2. Callithrix jacchus (white-tufted-ear marmoset) cja-miR-185
  3. Canis lupus familiaris (dog) cfa-miR-185
  4. Cavia porcellus (domestic guinea pig) cpo-miR-185-5p
  5. Cervus elaphus (red deer) cel-miR-185
  6. Cricetulus griseus (Chinese hamster) cgr-miR-185-5p
  7. Dasypus novemcinctus dno-miR-185-5p
  8. Gorilla gorilla gorilla ggo-miR-185 (MIR185)
  9. Gorilla gorilla (western gorilla) ggo-miR-185
  10. Homo sapiens (human) hsa-miR-185-5p
  11. Macaca mulatta (Rhesus monkey) mml-miR-185-5p
  12. Mus musculus mmu-miR-185-5p
  13. Oryctolagus cuniculus ocu-miR-185-5p
  14. Pan troglodytes ptr-miR-185
  15. Pongo pygmaeus (Bornean orangutan) ppy-miR-185
  16. Pteropus alecto pal-miR-185-5p
  17. Sus scrofa ssc-miR-185
  18. Tupaia chinensis (Chinese tree shrew) tch-miR-185-5p
Publications