Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Bos taurus (cattle) bta-miR-185 URS00004176D4_9913

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

bta-mir-185: Bta-mir-185 is a microRNA that has been studied in the context of milk exosomes under normal conditions and after S. aureus infection. It has been found that bta-mir-185 remained constant in terms of expression between day 9 and day 16 [PMC5487392]. Functional validation has shown that bta-mir-185 targets the PGM1 gene [PMC6896338]. Target prediction programs have identified a total of 814 target genes for bta-mir-185 [PMC6896338]. The binding sites for bta-mir-185 in the 3'-UTR of target genes have been analyzed using bioinformatics methods [PMC6896338]. Luciferase assays have confirmed that DYRK1B, MLLT3, HP1BP3, NPR2, and PGM1 are target genes of bta-mir-185 [PMC6896338]. Bta-mir-185 has been found to be highly expressed in milk exosomes from cows infected with S. aureus compared to control cows [PMC6896338]. It has also been identified as targeting MLLT3, DYRK1B, and NPR2 genes [PMC8578396]. Bta-mir-185 is evolutionarily close between cows and wild yaks compared to other microRNAs such as bta-miR-24-3p and bta-miR-874 [PMC8578396]. In milk from mammary glands infected with S. aureus, bta-mir-185 is significantly up-regulated along with miR-378 and miR146b [PMC7401532]. References: [PMC5487392]: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC5487392/ [PMC6896338]: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC6896338/ [PMC8578396]: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC8578396/ [PMC7401532]: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC7401532/

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGGAGAGAAAGGCAGUUCCUGA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 18 other species

  1. Callithrix jacchus (white-tufted-ear marmoset) cja-miR-185
  2. Canis lupus familiaris (dog) cfa-miR-185
  3. Cavia porcellus (domestic guinea pig) cpo-miR-185-5p
  4. Cervus elaphus (red deer) cel-miR-185
  5. Cricetulus griseus (Chinese hamster) cgr-miR-185-5p
  6. Dasypus novemcinctus dno-miR-185-5p
  7. Gorilla gorilla gorilla ggo-miR-185 (MIR185)
  8. Gorilla gorilla (western gorilla) ggo-miR-185
  9. Homo sapiens (human) hsa-miR-185-5p
  10. Macaca mulatta (Rhesus monkey) mml-miR-185-5p
  11. Mus musculus mmu-miR-185-5p
  12. Oryctolagus cuniculus ocu-miR-185-5p
  13. Pan troglodytes ptr-miR-185
  14. Pongo pygmaeus (Bornean orangutan) ppy-miR-185
  15. Pteropus alecto pal-miR-185-5p
  16. Rattus norvegicus (Norway rat) rno-miR-185-5p
  17. Sus scrofa ssc-miR-185
  18. Tupaia chinensis (Chinese tree shrew) tch-miR-185-5p
Publications