Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Bos taurus (domestic cattle) bta-miR-185 URS00004176D4_9913

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

bta-mir-185: bta-mir-185 is a microRNA identified in bovine milk exosomes, which remained constant in expression between day 9 and day 16 after S. aureus infection [PMC5487392]. It is known to target specific genes, including DYRK1B, MLLT3, HP1BP3, NPR2, and PGM1 [PMC6896338]. The expression of bta-mir-185 was significantly up-regulated in exosomes from bovine milk infected by S. aureus [PMC6896338], and it was one of the microRNAs with the highest number of predicted target genes (515 genes) [PMC6896338]. The functional relevance of bta-mir-185 was further supported by the down-regulation of luciferase activities in vectors containing the 3′-UTR sequences of its target genes [PMC6896338]. Additionally, bta-mir-185 showed increased expression in milk from cows infected with S. aureus compared to healthy cows [PMC8578396], highlighting its potential role as a biomarker for infection or as a participant in the host's response to infection.

mRNA interactions total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGGAGAGAAAGGCAGUUCCUGA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 22 other species

  1. Callithrix jacchus cja-miR-185
  2. Canis lupus familiaris cfa-miR-185
  3. Cavia porcellus (domestic guinea pig) cpo-miR-185-5p
  4. Cervus elaphus (red deer) cel-miR-185
  5. Cricetulus griseus cgr-miR-185-5p
  6. Dasypus novemcinctus (nine-banded armadillo) dno-miR-185-5p
  7. Equus caballus (horse) Eca-Mir-185_5p (mature (guide))
  8. Gorilla gorilla gorilla ggo-miR-185 (MIR185)
  9. Gorilla gorilla ggo-miR-185
  10. Homo sapiens hsa-miR-185-5p
  11. Loxodonta africana (African savanna elephant) Laf-Mir-185_5p (mature (guide))
  12. Macaca mulatta mml-miR-185-5p
  13. Microcebus murinus (gray mouse lemur) Mmr-Mir-185_5p (mature (guide))
  14. Mus musculus mmu-miR-185-5p
  15. Oryctolagus cuniculus (rabbit) ocu-miR-185-5p
  16. Pan troglodytes ptr-miR-185
  17. Pongo abelii (Sumatran orangutan) Pab-Mir-185_5p (mature (guide))
  18. Pongo pygmaeus ppy-miR-185
  19. Pteropus alecto (black flying fox) pal-miR-185-5p
  20. Rattus norvegicus rno-miR-185-5p
  21. Sus scrofa ssc-miR-185
  22. Tupaia belangeri chinensis tch-miR-185-5p
Relationships

Molecular Relationships

Publications