Dasypus novemcinctus (nine-banded armadillo) dno-miR-185-5p URS00004176D4_9361

• 22 nucleotides
• 2 databases (miRBase, MirGeneDB)
• Found in 18 other species
• 1. sncRNA
  2. small regulatory ncRNA
  3. miRNA

Genome locations

Gene Ontology annotations

Ancestor Chart

Loading ontology ancestors... Failed to load QuickGO Ancestor chart

×

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

{{ showSequence ? "Hide sequence" : "Show sequence" }}

Copy as RNA Copy as DNA

Search for similar sequences

UGGAGAGAAAGGCAGUUCCUGA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 18 other species

1. Bos taurus (cattle) bta-miR-185
2. Callithrix jacchus (white-tufted-ear marmoset) cja-miR-185
3. Canis lupus familiaris (dog) cfa-miR-185
4. Cavia porcellus (domestic guinea pig) cpo-miR-185-5p
5. Cervus elaphus (red deer) cel-miR-185
6. Cricetulus griseus (Chinese hamster) cgr-miR-185-5p
7. Gorilla gorilla gorilla ggo-miR-185 (MIR185)
8. Gorilla gorilla (western gorilla) ggo-miR-185
9. Homo sapiens (human) hsa-miR-185-5p
10. Macaca mulatta (Rhesus monkey) mml-miR-185-5p
11. Mus musculus mmu-miR-185-5p
12. Oryctolagus cuniculus ocu-miR-185-5p
13. Pan troglodytes ptr-miR-185
14. Pongo pygmaeus (Bornean orangutan) ppy-miR-185
15. Pteropus alecto pal-miR-185-5p
16. Rattus norvegicus (Norway rat) rno-miR-185-5p
17. Sus scrofa ssc-miR-185
18. Tupaia chinensis (Chinese tree shrew) tch-miR-185-5p

Download

• FASTA
• JSON