Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Cervus elaphus (red deer) cel-miR-185 URS00004176D4_9860

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGGAGAGAAAGGCAGUUCCUGA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 18 other species

  1. Bos taurus (cattle) bta-miR-185
  2. Callithrix jacchus (white-tufted-ear marmoset) cja-miR-185
  3. Canis lupus familiaris (dog) cfa-miR-185
  4. Cavia porcellus (domestic guinea pig) cpo-miR-185-5p
  5. Cricetulus griseus (Chinese hamster) cgr-miR-185-5p
  6. Dasypus novemcinctus dno-miR-185-5p
  7. Gorilla gorilla gorilla ggo-miR-185 (MIR185)
  8. Gorilla gorilla (western gorilla) ggo-miR-185
  9. Homo sapiens (human) hsa-miR-185-5p
  10. Macaca mulatta (Rhesus monkey) mml-miR-185-5p
  11. Mus musculus mmu-miR-185-5p
  12. Oryctolagus cuniculus ocu-miR-185-5p
  13. Pan troglodytes ptr-miR-185
  14. Pongo pygmaeus (Bornean orangutan) ppy-miR-185
  15. Pteropus alecto pal-miR-185-5p
  16. Rattus norvegicus (Norway rat) rno-miR-185-5p
  17. Sus scrofa ssc-miR-185
  18. Tupaia chinensis (Chinese tree shrew) tch-miR-185-5p