Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Sus scrofa (pig) ssc-miR-185 URS00004176D4_9823

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

ssc-mir-185: ssc-mir-185 is a microRNA implicated in various biological processes and diseases in pigs. It has been associated with different types of cancer, including gastric cancer, and is known to play a role in immune and inflammatory responses [PMC10122348]. This microRNA has been identified as a key regulator in the ceRNA network, where it interacts with circRNAs such as circ-FBXW4 and circ-ZEB1 to influence the regulation of genes like MYLK and FN1 [PMC10122348]. Additionally, ssc-mir-185 is upregulated in E. coli F18-susceptible pigs and is regulated by transcription factors that influence piglet diarrhea [PMC3427155]. It also affects T cell differentiation [PMC6354428] and has been linked to immune cell differentiation, B cell ontogeny, protective antibody production, host protective responses, parasite growth [PMC6354428], as well as the regulation of genes involved in leukocyte migration and chemokine activity [PMC8851844]. ssc-mir-185's role extends to adipocyte differentiation processes [PMC8834144] and its expression profiles have been studied in piglets with Clostridium perfringens type C infection where it was differentially expressed between resistant and susceptible groups [PMC8100468]. The miRNA's sequence conservation across vertebrates suggests its fundamental biological importance [PMC8100468], further emphasized by its upregulation in resistant groups of diarrhea piglets which indicates a potential protective role against infection-related gastrointestinal disturbances [PMC8100468].

mRNA interactions total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGGAGAGAAAGGCAGUUCCUGA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 22 other species

  1. Bos taurus (domestic cattle) bta-miR-185
  2. Callithrix jacchus cja-miR-185
  3. Canis lupus familiaris cfa-miR-185
  4. Cavia porcellus (domestic guinea pig) cpo-miR-185-5p
  5. Cervus elaphus (red deer) cel-miR-185
  6. Cricetulus griseus cgr-miR-185-5p
  7. Dasypus novemcinctus (nine-banded armadillo) dno-miR-185-5p
  8. Equus caballus (horse) Eca-Mir-185_5p (mature (guide))
  9. Gorilla gorilla gorilla ggo-miR-185 (MIR185)
  10. Gorilla gorilla ggo-miR-185
  11. Homo sapiens hsa-miR-185-5p
  12. Loxodonta africana (African savanna elephant) Laf-Mir-185_5p (mature (guide))
  13. Macaca mulatta mml-miR-185-5p
  14. Microcebus murinus (gray mouse lemur) Mmr-Mir-185_5p (mature (guide))
  15. Mus musculus mmu-miR-185-5p
  16. Oryctolagus cuniculus (rabbit) ocu-miR-185-5p
  17. Pan troglodytes ptr-miR-185
  18. Pongo abelii (Sumatran orangutan) Pab-Mir-185_5p (mature (guide))
  19. Pongo pygmaeus ppy-miR-185
  20. Pteropus alecto (black flying fox) pal-miR-185-5p
  21. Rattus norvegicus rno-miR-185-5p
  22. Tupaia belangeri chinensis tch-miR-185-5p
Relationships

Molecular Relationships

Publications