v26

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Canis lupus familiaris (dog) cfa-miR-127 URS00001E3DAA_9615

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
UCGGAUCCGUCUGAGCUUGGCU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 31 other species

  1. Ateles geoffroyi age-miR-127
  2. Bos taurus (domestic cattle) bta-miR-127
  3. Callithrix jacchus (white-tufted-ear marmoset) Cja-Mir-127_3p (mature (co-guide))
  4. Cavia porcellus cpo-miR-127-3p
  5. Cervus elaphus cel-miR-127
  6. Cricetulus griseus cgr-miR-127
  7. Dasypus novemcinctus (nine-banded armadillo) dno-miR-127-3p
  8. Daubentonia madagascariensis (aye-aye) dma-miR-127
  9. Echinops telfairi Ete-Mir-127_3p (mature (guide))
  10. Equus caballus (horse) eca-miR-127
  11. Homo sapiens hsa-miR-127-3p
  12. Lagothrix lagotricha (brown woolly monkey) lla-miR-127
  13. Loxodonta africana (African savanna elephant) Laf-Mir-127_3p (mature (guide))
  14. Macaca mulatta (Rhesus monkey) mml-miR-127-3p
  15. Macaca nemestrina mne-miR-127
  16. Microcebus murinus (gray mouse lemur) Mmr-Mir-127_3p (mature (guide))
  17. Mus musculus mmu-miR-127-3p
  18. Nomascus leucogenys (northern white-cheeked gibbon) nle-miR-127
  19. Oryctolagus cuniculus ocu-miR-127-3p
  20. Otolemur garnettii (small-eared galago) oga-miR-127
  21. Pan paniscus ppa-miR-127
  22. Pan troglodytes (chimpanzee) ptr-miR-127
  23. Papio hamadryas (hamadryas baboon) pha-miR-127
  24. Pongo abelii (Sumatran orangutan) Pab-Mir-127_3p (mature (co-guide))
  25. Pongo pygmaeus ppy-miR-127
  26. Pteropus alecto (black flying fox) pal-miR-127-3p
  27. Rattus norvegicus rno-miR-127-3p
  28. Saguinus labiatus sla-miR-127
  29. Saimiri boliviensis boliviensis (Bolivian squirrel monkey) sbo-miR-127
  30. Sus scrofa (pig) ssc-miR-127
  31. Tupaia chinensis (Chinese tree shrew) tch-miR-127-3p
 Relationships

Molecular Relationships

 Publications