Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-127-3p URS00001E3DAA_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-127: Hsa-mir-127 is a microRNA that has been implicated in the pathogenesis of Epstein-Barr virus (EBV)-positive Burkitt lymphoma (BL) [PMC3432484]. EBV is a virus that infects humans and persists in the body without causing disease in about 90% of adults [5]. However, EBV is associated with the development of various malignancies, including nasopharyngeal carcinoma and Hodgkin's lymphoma [4]. In EBV-positive BL, the virus is present in more than 90% of cases [26]. While BL has been considered a tumor of germinal center (GC) origin, recent findings suggest that the pattern and rate of somatic hypermutations in EBV-positive BLs are similar to those found in memory B-cells from peripheral blood [11, 27]. This discrepancy may be due to altered expression of hsa-mir-127 in EBV-positive BL cases compared to EBV-negative cases and normal controls [19, 29]. Upregulation of hsa-mir-127 may lead to downregulation of BLIMP-1 and XBP-1 expression, resulting in persistence of BCL-6 expression and maintenance of the GC phenotype [12]. Additionally, putative targets of hsa-mir-127 have been found to be enriched in an eBL signature [30]. While studies are providing increasing evidence on miRNA deregulation in this tumor, data on hsa-mir-127 remains limited [PMC3432484].

Genome locations

Gene Ontology annotations

Localisation

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UCGGAUCCGUCUGAGCUUGGCU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 27 other species

  1. Ateles geoffroyi age-miR-127
  2. Bos taurus (cattle) bta-miR-127
  3. Canis lupus familiaris cfa-miR-127
  4. Cavia porcellus cpo-miR-127-3p
  5. Cervus elaphus (red deer) cel-miR-127
  6. Cricetulus griseus (Chinese hamster) cgr-miR-127
  7. Dasypus novemcinctus (nine-banded armadillo) dno-miR-127-3p
  8. Daubentonia madagascariensis (aye-aye) dma-miR-127
  9. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-127_3p (mature (guide))
  10. Equus caballus (horse) eca-miR-127
  11. Lagothrix lagotricha (brown woolly monkey) lla-miR-127
  12. Macaca mulatta (Rhesus monkey) mml-miR-127-3p
  13. Macaca nemestrina mne-miR-127
  14. Mus musculus mmu-miR-127-3p
  15. Nomascus leucogenys (northern white-cheeked gibbon) nle-miR-127
  16. Oryctolagus cuniculus (rabbit) ocu-miR-127-3p
  17. Otolemur garnettii (small-eared galago) oga-miR-127
  18. Pan paniscus (pygmy chimpanzee) ppa-miR-127
  19. Pan troglodytes ptr-miR-127
  20. Papio hamadryas pha-miR-127
  21. Pongo pygmaeus ppy-miR-127
  22. Pteropus alecto pal-miR-127-3p
  23. Rattus norvegicus rno-miR-127-3p
  24. Saguinus labiatus sla-miR-127
  25. Saimiri boliviensis boliviensis (Bolivian squirrel monkey) sbo-miR-127
  26. Sus scrofa ssc-miR-127
  27. Tupaia chinensis tch-miR-127-3p
Publications