v27

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Saguinus labiatus (red-chested mustached tamarin) sla-miR-127 URS00001E3DAA_78454

mRNA interactions total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
UCGGAUCCGUCUGAGCUUGGCU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 31 other species

  1. Ateles geoffroyi age-miR-127
  2. Bos taurus (domestic cattle) bta-miR-127
  3. Callithrix jacchus (white-tufted-ear marmoset) Cja-Mir-127_3p (mature (co-guide))
  4. Canis lupus familiaris (dog) cfa-miR-127
  5. Cavia porcellus cpo-miR-127-3p
  6. Cervus elaphus (red deer) cel-miR-127
  7. Cricetulus griseus (Chinese hamster) cgr-miR-127
  8. Dasypus novemcinctus dno-miR-127-3p
  9. Daubentonia madagascariensis dma-miR-127
  10. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-127_3p (mature (guide))
  11. Equus caballus eca-miR-127
  12. Homo sapiens (human) hsa-miR-127-3p
  13. Lagothrix lagotricha lla-miR-127
  14. Loxodonta africana (African savanna elephant) Laf-Mir-127_3p (mature (guide))
  15. Macaca mulatta (Rhesus monkey) mml-miR-127-3p
  16. Macaca nemestrina (pig-tailed macaque) mne-miR-127
  17. Microcebus murinus (gray mouse lemur) Mmr-Mir-127_3p (mature (guide))
  18. Mus musculus (house mouse) mmu-miR-127-3p
  19. Nomascus leucogenys nle-miR-127
  20. Oryctolagus cuniculus (rabbit) ocu-miR-127-3p
  21. Otolemur garnettii oga-miR-127
  22. Pan paniscus (pygmy chimpanzee) ppa-miR-127
  23. Pan troglodytes (chimpanzee) ptr-miR-127
  24. Papio hamadryas (hamadryas baboon) pha-miR-127
  25. Pongo abelii (Sumatran orangutan) Pab-Mir-127_3p (mature (co-guide))
  26. Pongo pygmaeus (Bornean orangutan) ppy-miR-127
  27. Pteropus alecto pal-miR-127-3p
  28. Rattus norvegicus rno-miR-127-3p
  29. Saimiri boliviensis boliviensis (Bolivian squirrel monkey) sbo-miR-127
  30. Sus scrofa ssc-miR-127
  31. Tupaia belangeri chinensis tch-miR-127-3p
 Relationships

Molecular Relationships