Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Equus caballus (horse) eca-miR-127 URS00001E3DAA_9796

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

eca-mir-127: Eca-mir-127 is a microRNA that has been studied as a potential diagnostic biomarker for equine sarcoid (ES) disease. However, its diagnostic power is weak, with sensitivities and specificities around or below 60% [1]. Interestingly, the diagnostic ability of eca-mir-127 appears to be highly dependent on the breed of the equids. In Franches-Montagnes horses, eca-mir-127 reached a sensitivity of 91% and a specificity of 83% for diagnosing ES, while in Swiss Warmblood horses it was non-diagnostic [1]. Male equids showed higher levels of eca-mir-127 in whole blood than female equids [1]. Additionally, horses showed higher expression of eca-miR-379 and eca-miR-432 compared to donkeys [1]. Eca-mir-127, eca-miR-379, and eca-miR-432 are all encoded by a large miRNA cluster on equine chromosome 24 that has been proposed to play a role in ES pathogenesis [1]. The expression levels of these miRNAs are influenced by biological variables such as breed and sex [1]. Eca-mir-127 was confirmed as a diagnostic predictor for ES in equids but with poor sensitivity and specificity [1]. Reference: [1] Cosandey A et al. (2022) Whole blood microRNA expression profiles as potential biomarkers for sarcoid disease in horses. PLoS One. 17(2):e0262022.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UCGGAUCCGUCUGAGCUUGGCU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 27 other species

  1. Ateles geoffroyi age-miR-127
  2. Bos taurus (cattle) bta-miR-127
  3. Canis lupus familiaris cfa-miR-127
  4. Cavia porcellus cpo-miR-127-3p
  5. Cervus elaphus (red deer) cel-miR-127
  6. Cricetulus griseus (Chinese hamster) cgr-miR-127
  7. Dasypus novemcinctus (nine-banded armadillo) dno-miR-127-3p
  8. Daubentonia madagascariensis (aye-aye) dma-miR-127
  9. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-127_3p (mature (guide))
  10. Homo sapiens (human) hsa-miR-127-3p
  11. Lagothrix lagotricha (brown woolly monkey) lla-miR-127
  12. Macaca mulatta (Rhesus monkey) mml-miR-127-3p
  13. Macaca nemestrina mne-miR-127
  14. Mus musculus mmu-miR-127-3p
  15. Nomascus leucogenys (northern white-cheeked gibbon) nle-miR-127
  16. Oryctolagus cuniculus (rabbit) ocu-miR-127-3p
  17. Otolemur garnettii (small-eared galago) oga-miR-127
  18. Pan paniscus (pygmy chimpanzee) ppa-miR-127
  19. Pan troglodytes ptr-miR-127
  20. Papio hamadryas pha-miR-127
  21. Pongo pygmaeus ppy-miR-127
  22. Pteropus alecto pal-miR-127-3p
  23. Rattus norvegicus rno-miR-127-3p
  24. Saguinus labiatus sla-miR-127
  25. Saimiri boliviensis boliviensis (Bolivian squirrel monkey) sbo-miR-127
  26. Sus scrofa ssc-miR-127
  27. Tupaia chinensis tch-miR-127-3p
Publications