Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Rattus norvegicus (Norway rat) rno-miR-127-3p URS00001E3DAA_10116

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

rno-mir-127: rno-mir-127 is a microRNA that plays a significant role in the cellular response to ischemia/reperfusion (I/R) injury in rat proximal tubule cells [PMC3433485]. Its induction is associated with the protection of cell structure, including the maintenance of cell-matrix and cell-cell adhesions, by downregulating KIF3B, a component of the kinesin II complex [PMC3433485]. This microRNA is notably upregulated during hypoxic conditions and after reperfusion, suggesting its involvement in cellular protection mechanisms during such stress [PMC3433485]. The overexpression of rno-mir-127 enhances cell adhesion and contributes to the integrity of the actin cytoskeleton and tight junctions, which are crucial for epithelial barrier function [PMC3433485]. KIF3B overexpression resulting from rno-mir-127 blockade indicates that KIF3B is a direct target of rno-mir-127, with implications for endocytic activity and cellular trafficking [PMC3433485]. The consistent modulation of rno-mir-127 during I/R injury underscores its potential as a therapeutic target for renal tissue damage mitigation by preserving cytoskeletal organization and preventing disassembly of focal adhesion complexes (FAC) and tight junctions (TJ) disorganization [PMC3433485][PMC4442302].

mRNA interactions total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UCGGAUCCGUCUGAGCUUGGCU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 31 other species

  1. Ateles geoffroyi age-miR-127
  2. Bos taurus (domestic cattle) bta-miR-127
  3. Callithrix jacchus (white-tufted-ear marmoset) Cja-Mir-127_3p (mature (co-guide))
  4. Canis lupus familiaris (dog) cfa-miR-127
  5. Cavia porcellus cpo-miR-127-3p
  6. Cervus elaphus (red deer) cel-miR-127
  7. Cricetulus griseus (Chinese hamster) cgr-miR-127
  8. Dasypus novemcinctus dno-miR-127-3p
  9. Daubentonia madagascariensis dma-miR-127
  10. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-127_3p (mature (guide))
  11. Equus caballus eca-miR-127
  12. Homo sapiens (human) hsa-miR-127-3p
  13. Lagothrix lagotricha lla-miR-127
  14. Loxodonta africana (African savanna elephant) Laf-Mir-127_3p (mature (guide))
  15. Macaca mulatta (Rhesus monkey) mml-miR-127-3p
  16. Macaca nemestrina (pig-tailed macaque) mne-miR-127
  17. Microcebus murinus (gray mouse lemur) Mmr-Mir-127_3p (mature (guide))
  18. Mus musculus (house mouse) mmu-miR-127-3p
  19. Nomascus leucogenys nle-miR-127
  20. Oryctolagus cuniculus (rabbit) ocu-miR-127-3p
  21. Otolemur garnettii oga-miR-127
  22. Pan paniscus (pygmy chimpanzee) ppa-miR-127
  23. Pan troglodytes (chimpanzee) ptr-miR-127
  24. Papio hamadryas (hamadryas baboon) pha-miR-127
  25. Pongo abelii (Sumatran orangutan) Pab-Mir-127_3p (mature (co-guide))
  26. Pongo pygmaeus (Bornean orangutan) ppy-miR-127
  27. Pteropus alecto pal-miR-127-3p
  28. Saguinus labiatus sla-miR-127
  29. Saimiri boliviensis boliviensis (Bolivian squirrel monkey) sbo-miR-127
  30. Sus scrofa ssc-miR-127
  31. Tupaia belangeri chinensis tch-miR-127-3p
Relationships

Molecular Relationships

Publications