Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Bos taurus (cattle) bta-miR-127 URS00001E3DAA_9913

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

bta-mir-127: Bta-mir-127 is a microRNA that has been studied in various contexts. It has been found to be downregulated during a specific time period in adipocytes and adipo-exosomes [PMC7730049]. In mature oocytes, bta-mir-127 is one of the seven differentially expressed miRNAs involved in catabolic processes [PMC7505075]. Additionally, bta-mir-127 is one of the miRNAs that overlap between X and Y sperm, with higher enrichment in Y sperm [PMC7505075]. In humans, there are identical miRNAs to bta-mir-127 [PMC8787201]. Bta-mir-127 has been found to target multiple genes, with the greatest number of target genes being RTL1 [PMC8787201]. It has also been investigated as a negative regulator of target genes such as PYGB/COL5A1 and PPARG/SLC16A1 [PMC6720277]. In udder parenchyma tissue infected with CoNS, bta-mir-127 is one of the differentially expressed miRNAs, being upregulated along with other miRNAs such as bta-miR-142-5p and bta-miR-143 [PMC7937231]. Overall, bta-mir-127 plays a role in various biological processes and has been found to be differentially expressed in different contexts.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UCGGAUCCGUCUGAGCUUGGCU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 27 other species

  1. Ateles geoffroyi age-miR-127
  2. Canis lupus familiaris cfa-miR-127
  3. Cavia porcellus cpo-miR-127-3p
  4. Cervus elaphus (red deer) cel-miR-127
  5. Cricetulus griseus (Chinese hamster) cgr-miR-127
  6. Dasypus novemcinctus (nine-banded armadillo) dno-miR-127-3p
  7. Daubentonia madagascariensis (aye-aye) dma-miR-127
  8. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-127_3p (mature (guide))
  9. Equus caballus (horse) eca-miR-127
  10. Homo sapiens (human) hsa-miR-127-3p
  11. Lagothrix lagotricha (brown woolly monkey) lla-miR-127
  12. Macaca mulatta (Rhesus monkey) mml-miR-127-3p
  13. Macaca nemestrina mne-miR-127
  14. Mus musculus mmu-miR-127-3p
  15. Nomascus leucogenys (northern white-cheeked gibbon) nle-miR-127
  16. Oryctolagus cuniculus (rabbit) ocu-miR-127-3p
  17. Otolemur garnettii (small-eared galago) oga-miR-127
  18. Pan paniscus (pygmy chimpanzee) ppa-miR-127
  19. Pan troglodytes ptr-miR-127
  20. Papio hamadryas pha-miR-127
  21. Pongo pygmaeus ppy-miR-127
  22. Pteropus alecto pal-miR-127-3p
  23. Rattus norvegicus rno-miR-127-3p
  24. Saguinus labiatus sla-miR-127
  25. Saimiri boliviensis boliviensis (Bolivian squirrel monkey) sbo-miR-127
  26. Sus scrofa ssc-miR-127
  27. Tupaia chinensis tch-miR-127-3p
Publications