Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Callithrix jacchus (white-tufted-ear marmoset) Cja-Mir-127_3p (mature (co-guide)) URS00001E3DAA_9483

mRNA interactions total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UCGGAUCCGUCUGAGCUUGGCU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 31 other species

  1. Ateles geoffroyi age-miR-127
  2. Bos taurus (domestic cattle) bta-miR-127
  3. Canis lupus familiaris (dog) cfa-miR-127
  4. Cavia porcellus cpo-miR-127-3p
  5. Cervus elaphus (red deer) cel-miR-127
  6. Cricetulus griseus (Chinese hamster) cgr-miR-127
  7. Dasypus novemcinctus dno-miR-127-3p
  8. Daubentonia madagascariensis dma-miR-127
  9. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-127_3p (mature (guide))
  10. Equus caballus eca-miR-127
  11. Homo sapiens (human) hsa-miR-127-3p
  12. Lagothrix lagotricha lla-miR-127
  13. Loxodonta africana (African savanna elephant) Laf-Mir-127_3p (mature (guide))
  14. Macaca mulatta (Rhesus monkey) mml-miR-127-3p
  15. Macaca nemestrina (pig-tailed macaque) mne-miR-127
  16. Microcebus murinus (gray mouse lemur) Mmr-Mir-127_3p (mature (guide))
  17. Mus musculus (house mouse) mmu-miR-127-3p
  18. Nomascus leucogenys nle-miR-127
  19. Oryctolagus cuniculus (rabbit) ocu-miR-127-3p
  20. Otolemur garnettii oga-miR-127
  21. Pan paniscus (pygmy chimpanzee) ppa-miR-127
  22. Pan troglodytes (chimpanzee) ptr-miR-127
  23. Papio hamadryas (hamadryas baboon) pha-miR-127
  24. Pongo abelii (Sumatran orangutan) Pab-Mir-127_3p (mature (co-guide))
  25. Pongo pygmaeus (Bornean orangutan) ppy-miR-127
  26. Pteropus alecto pal-miR-127-3p
  27. Rattus norvegicus rno-miR-127-3p
  28. Saguinus labiatus sla-miR-127
  29. Saimiri boliviensis boliviensis (Bolivian squirrel monkey) sbo-miR-127
  30. Sus scrofa ssc-miR-127
  31. Tupaia belangeri chinensis tch-miR-127-3p
Relationships

Molecular Relationships