Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Ateles geoffroyi (black-handed spider monkey) age-miR-127 URS00001E3DAA_9509

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UCGGAUCCGUCUGAGCUUGGCU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 27 other species

  1. Bos taurus (cattle) bta-miR-127
  2. Canis lupus familiaris cfa-miR-127
  3. Cavia porcellus cpo-miR-127-3p
  4. Cervus elaphus (red deer) cel-miR-127
  5. Cricetulus griseus (Chinese hamster) cgr-miR-127
  6. Dasypus novemcinctus (nine-banded armadillo) dno-miR-127-3p
  7. Daubentonia madagascariensis (aye-aye) dma-miR-127
  8. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-127_3p (mature (guide))
  9. Equus caballus (horse) eca-miR-127
  10. Homo sapiens (human) hsa-miR-127-3p
  11. Lagothrix lagotricha (brown woolly monkey) lla-miR-127
  12. Macaca mulatta (Rhesus monkey) mml-miR-127-3p
  13. Macaca nemestrina mne-miR-127
  14. Mus musculus mmu-miR-127-3p
  15. Nomascus leucogenys (northern white-cheeked gibbon) nle-miR-127
  16. Oryctolagus cuniculus (rabbit) ocu-miR-127-3p
  17. Otolemur garnettii (small-eared galago) oga-miR-127
  18. Pan paniscus (pygmy chimpanzee) ppa-miR-127
  19. Pan troglodytes ptr-miR-127
  20. Papio hamadryas pha-miR-127
  21. Pongo pygmaeus ppy-miR-127
  22. Pteropus alecto pal-miR-127-3p
  23. Rattus norvegicus rno-miR-127-3p
  24. Saguinus labiatus sla-miR-127
  25. Saimiri boliviensis boliviensis (Bolivian squirrel monkey) sbo-miR-127
  26. Sus scrofa ssc-miR-127
  27. Tupaia chinensis tch-miR-127-3p
Publications