Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Mus musculus (house mouse) mmu-miR-127-3p URS00001E3DAA_10090

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

mmu-mir-127: mmu-mir-127 is a primary microRNA (pri-miRNA) that is involved in the regulation of gene expression and has been identified as a significant player in lung development and various cancers [PMC7904729]. This miRNA is located in an imprinted locus on the genome and is expressed from the maternally inherited chromosome [PMC3712712]. Despite its importance, mmu-mir-127 was omitted from further analysis in one study due to a lack of identified targets that met specific criteria [PMC9657954]. However, it was found to be one of the 15 up-regulated miRNAs in another study, indicating its potential role in gene regulation [PMC4989891]. The expression of mmu-mir-127 is crucial for lung development, as its overexpression can lead to impaired lung branching [PMC4065842]. Additionally, mmu-mir-127 has been implicated in various cancers, with its differential expression noted across multiple cancer subtypes and a significant up-regulation associated with KRAS mutations in colorectal cancer [PMC4065842]. The downregulation of mmu-mir-127 may result in the upregulation of MAPK pathways, for which it is a direct target [PMC9321239]. Furthermore, mmu-mir-127 expression was found to be low or undetected during B-cell differentiation after germinal center (GC) reactions, suggesting it needs to be downregulated during this process [PMC3432484].

mRNA interactions total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UCGGAUCCGUCUGAGCUUGGCU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 31 other species

  1. Ateles geoffroyi age-miR-127
  2. Bos taurus (domestic cattle) bta-miR-127
  3. Callithrix jacchus (white-tufted-ear marmoset) Cja-Mir-127_3p (mature (co-guide))
  4. Canis lupus familiaris (dog) cfa-miR-127
  5. Cavia porcellus cpo-miR-127-3p
  6. Cervus elaphus (red deer) cel-miR-127
  7. Cricetulus griseus (Chinese hamster) cgr-miR-127
  8. Dasypus novemcinctus dno-miR-127-3p
  9. Daubentonia madagascariensis dma-miR-127
  10. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-127_3p (mature (guide))
  11. Equus caballus eca-miR-127
  12. Homo sapiens (human) hsa-miR-127-3p
  13. Lagothrix lagotricha lla-miR-127
  14. Loxodonta africana (African savanna elephant) Laf-Mir-127_3p (mature (guide))
  15. Macaca mulatta (Rhesus monkey) mml-miR-127-3p
  16. Macaca nemestrina (pig-tailed macaque) mne-miR-127
  17. Microcebus murinus (gray mouse lemur) Mmr-Mir-127_3p (mature (guide))
  18. Nomascus leucogenys nle-miR-127
  19. Oryctolagus cuniculus (rabbit) ocu-miR-127-3p
  20. Otolemur garnettii oga-miR-127
  21. Pan paniscus (pygmy chimpanzee) ppa-miR-127
  22. Pan troglodytes (chimpanzee) ptr-miR-127
  23. Papio hamadryas (hamadryas baboon) pha-miR-127
  24. Pongo abelii (Sumatran orangutan) Pab-Mir-127_3p (mature (co-guide))
  25. Pongo pygmaeus (Bornean orangutan) ppy-miR-127
  26. Pteropus alecto pal-miR-127-3p
  27. Rattus norvegicus rno-miR-127-3p
  28. Saguinus labiatus sla-miR-127
  29. Saimiri boliviensis boliviensis (Bolivian squirrel monkey) sbo-miR-127
  30. Sus scrofa ssc-miR-127
  31. Tupaia belangeri chinensis tch-miR-127-3p
Relationships

Molecular Relationships

Publications