Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Mus musculus (house mouse) mmu-miR-127-3p URS00001E3DAA_10090

Automated summary: This miRNA sequence is 22 nucleotides long and is found in Mus musculus. Annotated by 7 databases (miRBase, TarBase, PirBase, RefSeq, MirGeneDB, LncBase, ENA). Described in 30 papers. Mus musculus (house mouse) mmu-miR-127-3p sequence is a product of Mir127, miR-127, mmu-miR-127, 127, mmu-miR-127-3p, miR-127-3p genes. Interacts with lncRNAs, such as (). Interacts with protein-coding genes, including 2410044B12Rik, Atf-4, Atf4, C/ATF, C81438, CREB2, ENSMUSG00000018362, ENSMUSG00000023944, ENSMUSG00000042406, ENSMUSG00000053198.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    UCGGAUCCGUCUGAGCUUGGCU

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 26 other species

    1. Ateles geoffroyi (black-handed spider monkey) age-miR-127
    2. Bos taurus bta-miR-127
    3. Canis lupus familiaris (dog) cfa-miR-127
    4. Cavia porcellus cpo-miR-127-3p
    5. Cervus elaphus cel-miR-127
    6. Cricetulus griseus cgr-miR-127
    7. Dasypus novemcinctus (nine-banded armadillo) dno-miR-127-3p
    8. Daubentonia madagascariensis (aye-aye) dma-miR-127
    9. Echinops telfairi Ete-Mir-127_3p (mature (guide))
    10. Equus caballus eca-miR-127
    11. Homo sapiens hsa-miR-127-3p
    12. Lagothrix lagotricha lla-miR-127
    13. Macaca mulatta (Rhesus monkey) mml-miR-127-3p
    14. Macaca nemestrina mne-miR-127
    15. Nomascus leucogenys nle-miR-127
    16. Oryctolagus cuniculus (rabbit) ocu-miR-127-3p
    17. Otolemur garnettii oga-miR-127
    18. Pan paniscus (pygmy chimpanzee) ppa-miR-127
    19. Pan troglodytes (chimpanzee) ptr-miR-127
    20. Papio hamadryas (hamadryas baboon) pha-miR-127
    21. Pongo pygmaeus ppy-miR-127
    22. Pteropus alecto (black flying fox) pal-miR-127-3p
    23. Rattus norvegicus (Norway rat) rno-miR-127-3p
    24. Saguinus labiatus sla-miR-127
    25. Saimiri boliviensis boliviensis (Bolivian squirrel monkey) sbo-miR-127
    26. Sus scrofa ssc-miR-127
    27. Tupaia chinensis tch-miR-127-3p