v26

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-200a-3p URS000008DA94_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-200a: hsa-mir-200a is identified as a pagetoid-specific upregulated microRNA (miRNA) that plays a role in epithelial-mesenchymal transition (EMT) and is implicated in ovarian cancer as an oncomiR, working in conjunction with hsa-miR-141 to target MAPK14, thereby enhancing the oxidative stress response that promotes tumor growth [PMC5951834]. This miRNA is also a component of a prognostic model for ovarian cancer, where its expression quantity is inversely related to the prognostic score, suggesting that higher levels of hsa-mir-200a may be associated with a better prognosis [PMC5588086]. Furthermore, hsa-mir-200a is among 17 miRNAs identified for further investigation due to their potential roles in cancer biology and their inclusion in the prognostic model [PMC6474298].

mRNA interactions 4 total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
UAACACUGUCUGGUAACGAUGU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 21 other species

  1. Alligator mississippiensis (American alligator) ami-miR-200a-3p
  2. Anolis carolinensis aca-miR-200a-3p
  3. Capra hircus (goat) miR-200a
  4. Chiloscyllium plagiosum microRNA cpl-miR-200a
  5. Danio rerio dre-miR-200a-3p
  6. Equus caballus (horse) eca-miR-200a
  7. Gadus morhua (Atlantic cod) gmo-miR-200a-3p
  8. Gallus gallus (chicken) gga-miR-200a-3p
  9. Gorilla gorilla gorilla ggo-miR-200a (MIR200A)
  10. Gorilla gorilla ggo-miR-200a
  11. Macaca mulatta (Rhesus monkey) mml-miR-200a-3p
  12. Monodelphis domestica (gray short-tailed opossum) mdo-miR-200a-3p
  13. Mus musculus (house mouse) mmu-miR-200a-3p
  14. Ovis aries (sheep) miscellaneous RNA
  15. Pan troglodytes (chimpanzee) ptr-miR-200a
  16. Pongo pygmaeus ppy-miR-200a
  17. Rattus norvegicus rno-miR-200a-3p
  18. Takifugu rubripes (torafugu) fru-miR-200a
  19. Tetraodon nigroviridis tni-miR-200a
  20. Tor tambroides (Thai mahseer) miR-200a-3p
  21. Xenopus tropicalis xtr-miR-200a
 Relationships

Molecular Relationships

 GoFlow Results Publications