Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Mus musculus (house mouse) mmu-miR-200a-3p URS000008DA94_10090

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

mmu-mir-200a: mmu-mir-200a, a microRNA, is implicated in various stages of cellular processes, interacting with different genes such as MEIS1 in early stages and BRCA1 in later stages [PMC3866260]. It is one of five miRNAs that participate in both early and late cellular stages [PMC3866260]. This miRNA, along with mmu-mir-200b, is part of the miR-200b/200a/429 cluster and is potentially upregulated by transcription factors including Sox2 and Pou5f1 [PMC7906897]. However, mmu-mir-200a can be downregulated in white adipose tissue (WAT) as a response to high-fat diet (HFD) feeding [PMC4571067], which can facilitate the expression of PTEN, influencing cell proliferation and apoptosis during decidualization [PMC5699189]. Shen et al. reported that mmu-mir-200a plays a crucial role in embryonic implantation by targeting the phosphatase and tensin homolog gene [PMC5364990]. Moreover, knockdown experiments have shown that reducing mmu-mir-200a levels can lead to increased expression of Dcx and Map2 positive cells which are indicative of neurogenesis [PMC3679101]. This microRNA's expression levels are significantly decreased in neural stem cells (NSCs) from diabetic pregnancies compared to controls [PMC3679101], highlighting its role in neurogenesis regulation.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UAACACUGUCUGGUAACGAUGU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 21 other species

  1. Alligator mississippiensis (American alligator) ami-miR-200a-3p
  2. Anolis carolinensis aca-miR-200a-3p
  3. Capra hircus (goat) miR-200a
  4. Chiloscyllium plagiosum microRNA cpl-miR-200a
  5. Danio rerio dre-miR-200a-3p
  6. Equus caballus (horse) eca-miR-200a
  7. Gadus morhua (Atlantic cod) gmo-miR-200a-3p
  8. Gallus gallus (chicken) gga-miR-200a-3p
  9. Gorilla gorilla gorilla ggo-miR-200a (MIR200A)
  10. Gorilla gorilla ggo-miR-200a
  11. Homo sapiens hsa-miR-200a-3p
  12. Macaca mulatta (Rhesus monkey) mml-miR-200a-3p
  13. Monodelphis domestica (gray short-tailed opossum) mdo-miR-200a-3p
  14. Ovis aries (sheep) miscellaneous RNA
  15. Pan troglodytes (chimpanzee) ptr-miR-200a
  16. Pongo pygmaeus ppy-miR-200a
  17. Rattus norvegicus rno-miR-200a-3p
  18. Takifugu rubripes (torafugu) fru-miR-200a
  19. Tetraodon nigroviridis tni-miR-200a
  20. Tor tambroides (Thai mahseer) miR-200a-3p
  21. Xenopus tropicalis xtr-miR-200a
Relationships

Molecular Relationships

Publications