Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Mus musculus (house mouse) mmu-miR-200a-3p URS000008DA94_10090

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

mmu-mir-200a: Mmu-mir-200a is a microRNA that plays different roles in the early and late stages of development, depending on its interactions with MEIS1 and BRCA1 [PMC3866260]. It is one of the five miRNAs, along with mmu-mir-200b, mmu-mir-135b, mmu-mir-494, and mmu-mir-503, that participate in both the early and late stages [PMC3866260]. Mmu-mir-200a and mmu-miR-200b are part of the miR-200b/200a/429 cluster and can be up-regulated by Sox2, Pitx2, Pou5f1, and Hnf1b [PMC7906897]. In a microarray experiment involving high-fat diet feeding in mice, mmu-miR-141 and mmu-mir-200a were downregulated [PMC4571067]. Down-regulation of mmu-mir-200a facilitated the expression of PTEN during decidualization [PMC5699189]. Mmu-mir-200a has been found to have an important role in embryonic implantation by targeting phosphatase and tensin homolog [PMC5364990]. In NSCs from diabetic pregnancy mice, reduced expression of miRNAs including mmu-mir-200a correlated with increased protein expression of Dcx and Pafah1b1 [PMC3679101]. Knockdown experiments showed that downregulation of mmu-miR-141 or mmu-miR-466a resulted in increased expression of Dcx in NSCs [PMC3679101]. The expression levels of miRNA including mmu-mir-200a were significantly decreased in NSCs from diabetic pregnancy compared to control samples [PMC3679101]. Mmu mir 466d 3p was found to target Gfap protein during neurogenesis in vitro when knocked down along with other miRNAs including mir 200a [PMC3679101].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UAACACUGUCUGGUAACGAUGU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 21 other species

  1. Alligator mississippiensis (American alligator) ami-miR-200a-3p
  2. Anolis carolinensis aca-miR-200a-3p
  3. Capra hircus (goat) miR-200a
  4. Chiloscyllium plagiosum microRNA cpl-miR-200a
  5. Danio rerio dre-miR-200a-3p
  6. Equus caballus eca-miR-200a
  7. Gadus morhua (Atlantic cod) gmo-miR-200a-3p
  8. Gallus gallus gga-miR-200a-3p
  9. Gorilla gorilla gorilla ggo-miR-200a (MIR200A)
  10. Gorilla gorilla ggo-miR-200a
  11. Homo sapiens hsa-miR-200a-3p
  12. Macaca mulatta mml-miR-200a-3p
  13. Monodelphis domestica mdo-miR-200a-3p
  14. Ovis aries (sheep) miscellaneous RNA
  15. Pan troglodytes (chimpanzee) ptr-miR-200a
  16. Pongo pygmaeus ppy-miR-200a
  17. Rattus norvegicus (Norway rat) rno-miR-200a-3p
  18. Takifugu rubripes fru-miR-200a
  19. Tetraodon nigroviridis (spotted green pufferfish) tni-miR-200a
  20. Tor tambroides miR-200a-3p
  21. Xenopus tropicalis (tropical clawed frog) xtr-miR-200a
Publications