Ovis aries (sheep) miscellaneous RNA

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Ovis aries (sheep) miscellaneous RNA URS000008DA94_9940

22 nucleotides
1 database (ENA)
Found in 21 other species
transcript

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

UAACACUGUCUGGUAACGAUGU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 21 other species

Alligator mississippiensis (American alligator) ami-miR-200a-3p
Anolis carolinensis aca-miR-200a-3p
Capra hircus (goat) miR-200a
Chiloscyllium plagiosum microRNA cpl-miR-200a
Danio rerio dre-miR-200a-3p
Equus caballus (horse) eca-miR-200a
Gadus morhua (Atlantic cod) gmo-miR-200a-3p
Gallus gallus (chicken) gga-miR-200a-3p
Gorilla gorilla gorilla ggo-miR-200a (MIR200A)
Gorilla gorilla ggo-miR-200a
Homo sapiens hsa-miR-200a-3p
Macaca mulatta (Rhesus monkey) mml-miR-200a-3p
Monodelphis domestica (gray short-tailed opossum) mdo-miR-200a-3p
Mus musculus (house mouse) mmu-miR-200a-3p
Pan troglodytes (chimpanzee) ptr-miR-200a
Pongo pygmaeus ppy-miR-200a
Rattus norvegicus rno-miR-200a-3p
Takifugu rubripes (torafugu) fru-miR-200a
Tetraodon nigroviridis tni-miR-200a
Tor tambroides (Thai mahseer) miR-200a-3p
Xenopus tropicalis xtr-miR-200a

Relationships