Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Alligator mississippiensis (American alligator) ami-miR-200a-3p URS000008DA94_8496

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UAACACUGUCUGGUAACGAUGU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 21 other species

  1. Anolis carolinensis aca-miR-200a-3p
  2. Capra hircus (goat) miR-200a
  3. Chiloscyllium plagiosum microRNA cpl-miR-200a
  4. Danio rerio dre-miR-200a-3p
  5. Equus caballus eca-miR-200a
  6. Gadus morhua (Atlantic cod) gmo-miR-200a-3p
  7. Gallus gallus gga-miR-200a-3p
  8. Gorilla gorilla gorilla ggo-miR-200a (MIR200A)
  9. Gorilla gorilla ggo-miR-200a
  10. Homo sapiens hsa-miR-200a-3p
  11. Macaca mulatta mml-miR-200a-3p
  12. Monodelphis domestica mdo-miR-200a-3p
  13. Mus musculus mmu-miR-200a-3p
  14. Ovis aries (sheep) miscellaneous RNA
  15. Pan troglodytes (chimpanzee) ptr-miR-200a
  16. Pongo pygmaeus ppy-miR-200a
  17. Rattus norvegicus (Norway rat) rno-miR-200a-3p
  18. Takifugu rubripes fru-miR-200a
  19. Tetraodon nigroviridis (spotted green pufferfish) tni-miR-200a
  20. Tor tambroides miR-200a-3p
  21. Xenopus tropicalis (tropical clawed frog) xtr-miR-200a