Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Tor tambroides (Thai mahseer) miR-200a-3p URS000008DA94_329116

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UAACACUGUCUGGUAACGAUGU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 21 other species

  1. Alligator mississippiensis (American alligator) ami-miR-200a-3p
  2. Anolis carolinensis aca-miR-200a-3p
  3. Capra hircus (goat) miR-200a
  4. Chiloscyllium plagiosum microRNA cpl-miR-200a
  5. Danio rerio dre-miR-200a-3p
  6. Equus caballus (horse) eca-miR-200a
  7. Gadus morhua (Atlantic cod) gmo-miR-200a-3p
  8. Gallus gallus (chicken) gga-miR-200a-3p
  9. Gorilla gorilla gorilla ggo-miR-200a (MIR200A)
  10. Gorilla gorilla ggo-miR-200a
  11. Homo sapiens hsa-miR-200a-3p
  12. Macaca mulatta (Rhesus monkey) mml-miR-200a-3p
  13. Monodelphis domestica (gray short-tailed opossum) mdo-miR-200a-3p
  14. Mus musculus (house mouse) mmu-miR-200a-3p
  15. Ovis aries (sheep) miscellaneous RNA
  16. Pan troglodytes (chimpanzee) ptr-miR-200a
  17. Pongo pygmaeus ppy-miR-200a
  18. Rattus norvegicus rno-miR-200a-3p
  19. Takifugu rubripes (torafugu) fru-miR-200a
  20. Tetraodon nigroviridis tni-miR-200a
  21. Xenopus tropicalis xtr-miR-200a
Relationships

Molecular Relationships