v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Tor tambroides (Thai mahseer) miR-200a-3p URS000008DA94_329116

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
UAACACUGUCUGGUAACGAUGU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 21 other species

  1. Alligator mississippiensis (American alligator) ami-miR-200a-3p
  2. Anolis carolinensis aca-miR-200a-3p
  3. Capra hircus (goat) miR-200a
  4. Chiloscyllium plagiosum microRNA cpl-miR-200a
  5. Danio rerio dre-miR-200a-3p
  6. Equus caballus eca-miR-200a
  7. Gadus morhua (Atlantic cod) gmo-miR-200a-3p
  8. Gallus gallus gga-miR-200a-3p
  9. Gorilla gorilla gorilla ggo-miR-200a (MIR200A)
  10. Gorilla gorilla ggo-miR-200a
  11. Homo sapiens hsa-miR-200a-3p
  12. Macaca mulatta mml-miR-200a-3p
  13. Monodelphis domestica mdo-miR-200a-3p
  14. Mus musculus mmu-miR-200a-3p
  15. Ovis aries (sheep) miscellaneous RNA
  16. Pan troglodytes (chimpanzee) ptr-miR-200a
  17. Pongo pygmaeus ppy-miR-200a
  18. Rattus norvegicus (Norway rat) rno-miR-200a-3p
  19. Takifugu rubripes fru-miR-200a
  20. Tetraodon nigroviridis (spotted green pufferfish) tni-miR-200a
  21. Xenopus tropicalis (tropical clawed frog) xtr-miR-200a