Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Equus caballus (horse) eca-miR-200a URS000008DA94_9796

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

eca-mir-200a: Eca-mir-200a is a microRNA observed in horses, particularly in the context of uterine health and disease [PMC8227551]. In a study focusing on the expression profiles of various microRNAs, eca-mir-200a was found to be significantly overexpressed in both young and old diseased mares when compared to healthy controls [PMC8227551]. This overexpression was more pronounced in old diseased mares, suggesting a potential age-related susceptibility or response to uterine disease [PMC8227551]. The study aimed to explore the expression of eca-mir-200a among other microRNAs and their relationship with inflammatory immune response genes, which are implicated in endometritis [PMC8227551]. While eca-mir-200a is part of a group of microRNAs that target inflammatory immune response genes, the specific genes targeted by eca-mir-200a were not directly linked to TNFα and IL6 in the provided context [PMC8227551]. This is the first study that investigates eca-mir-200a expression profiles during endometritis in mares' serum, highlighting its potential as a biomarker for the disease [PMC8227551]. Additionally, eca-mir-200a has been identified as a regulator of genes such as CDC25A and E2F3 which are crucial for cell cycle regulation [PMC9777602], suggesting its broader role beyond inflammation and potentially linking it to cell proliferation processes during uterine disease.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UAACACUGUCUGGUAACGAUGU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 21 other species

  1. Alligator mississippiensis (American alligator) ami-miR-200a-3p
  2. Anolis carolinensis aca-miR-200a-3p
  3. Capra hircus (goat) miR-200a
  4. Chiloscyllium plagiosum microRNA cpl-miR-200a
  5. Danio rerio dre-miR-200a-3p
  6. Gadus morhua (Atlantic cod) gmo-miR-200a-3p
  7. Gallus gallus (chicken) gga-miR-200a-3p
  8. Gorilla gorilla gorilla ggo-miR-200a (MIR200A)
  9. Gorilla gorilla ggo-miR-200a
  10. Homo sapiens hsa-miR-200a-3p
  11. Macaca mulatta (Rhesus monkey) mml-miR-200a-3p
  12. Monodelphis domestica (gray short-tailed opossum) mdo-miR-200a-3p
  13. Mus musculus (house mouse) mmu-miR-200a-3p
  14. Ovis aries (sheep) miscellaneous RNA
  15. Pan troglodytes (chimpanzee) ptr-miR-200a
  16. Pongo pygmaeus ppy-miR-200a
  17. Rattus norvegicus rno-miR-200a-3p
  18. Takifugu rubripes (torafugu) fru-miR-200a
  19. Tetraodon nigroviridis tni-miR-200a
  20. Tor tambroides (Thai mahseer) miR-200a-3p
  21. Xenopus tropicalis xtr-miR-200a
Relationships

Molecular Relationships

Publications