v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Gorilla gorilla (western gorilla) ggo-miR-200a URS000008DA94_9593

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
UAACACUGUCUGGUAACGAUGU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 21 other species

  1. Alligator mississippiensis (American alligator) ami-miR-200a-3p
  2. Anolis carolinensis aca-miR-200a-3p
  3. Capra hircus (goat) miR-200a
  4. Chiloscyllium plagiosum microRNA cpl-miR-200a
  5. Danio rerio dre-miR-200a-3p
  6. Equus caballus eca-miR-200a
  7. Gadus morhua (Atlantic cod) gmo-miR-200a-3p
  8. Gallus gallus gga-miR-200a-3p
  9. Gorilla gorilla gorilla ggo-miR-200a (MIR200A)
  10. Homo sapiens hsa-miR-200a-3p
  11. Macaca mulatta mml-miR-200a-3p
  12. Monodelphis domestica mdo-miR-200a-3p
  13. Mus musculus mmu-miR-200a-3p
  14. Ovis aries (sheep) miscellaneous RNA
  15. Pan troglodytes (chimpanzee) ptr-miR-200a
  16. Pongo pygmaeus ppy-miR-200a
  17. Rattus norvegicus (Norway rat) rno-miR-200a-3p
  18. Takifugu rubripes fru-miR-200a
  19. Tetraodon nigroviridis (spotted green pufferfish) tni-miR-200a
  20. Tor tambroides miR-200a-3p
  21. Xenopus tropicalis (tropical clawed frog) xtr-miR-200a
 Publications