v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-200a-3p URS000008DA94_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-200a: hsa-mir-200a is a pagetoid specific upregulated miRNA that is involved in epithelial-mesenchymal transition (EMT) and works in conjunction with hsa-miR-141 to target MAPK14, thereby enhancing the oxidative stress tumor growth response in ovarian cancer [PMC5951834]. These miRNAs, hsa-mir-200a and hsa-miR-141, act as oncomiRs [PMC5951834]. In a prognosis model constructed for ovarian cancer, the expression quantities of hsa-miR-101-1, hsa-mir-200a, hsa-miR-4661, and hsa-miR-450a-2 were used to calculate the prognostic score [PMC5588086]. A total of 17 miRNAs were identified for further investigation in ovarian cancer. These include hsa-mir-141, hsa-mir-383, hsa-mir-183, hsa-mir-205, hsa-mir106a, hsa-mir195,h sa mir200a,h sa mir429,h sa mir140,h sa mir32,h sa mir31,h sa mir143,h sa mir145,h sa mir204,h sa mir182,h sa mir210,andh sam ir100 [PMC6474298].

mRNA interactions 3 total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
UAACACUGUCUGGUAACGAUGU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 21 other species

  1. Alligator mississippiensis (American alligator) ami-miR-200a-3p
  2. Anolis carolinensis aca-miR-200a-3p
  3. Capra hircus (goat) miR-200a
  4. Chiloscyllium plagiosum microRNA cpl-miR-200a
  5. Danio rerio dre-miR-200a-3p
  6. Equus caballus eca-miR-200a
  7. Gadus morhua (Atlantic cod) gmo-miR-200a-3p
  8. Gallus gallus gga-miR-200a-3p
  9. Gorilla gorilla gorilla ggo-miR-200a (MIR200A)
  10. Gorilla gorilla ggo-miR-200a
  11. Macaca mulatta mml-miR-200a-3p
  12. Monodelphis domestica mdo-miR-200a-3p
  13. Mus musculus mmu-miR-200a-3p
  14. Ovis aries (sheep) miscellaneous RNA
  15. Pan troglodytes (chimpanzee) ptr-miR-200a
  16. Pongo pygmaeus ppy-miR-200a
  17. Rattus norvegicus (Norway rat) rno-miR-200a-3p
  18. Takifugu rubripes fru-miR-200a
  19. Tetraodon nigroviridis (spotted green pufferfish) tni-miR-200a
  20. Tor tambroides miR-200a-3p
  21. Xenopus tropicalis (tropical clawed frog) xtr-miR-200a
 Publications