Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-200a-3p URS000008DA94_9606

Automated summary: This miRNA sequence is 22 nucleotides long and is found in Homo sapiens. Annotated by 9 databases (PSICQUIC, ENA, LncBase, TarBase, MalaCards, GeneCards, RefSeq, miRBase, IntAct). Described in 74 papers. Homo sapiens (human) hsa-miR-200a-3p sequence is a product of hsa-miR-200a, miR-200, miR-200a, miR-200a-3p, MIR200A, hsa-miR-200a-3p genes. Found in the human reference genome. Interacts with lncRNAs, such as (). Interacts with protein-coding genes, including 133K02, 14-3-3GAMMA, 14-3-3γ, 1A6/DRIM, 3-PAP, 37LRP, 3PAP, 4F5REL, 5T4, 5T4-AG.

Interactions 4

According to PSICQUIC and IntAct, Homo sapiens (human) hsa-miR-200a-3p interacts with:

Interaction id Participant Synonyms
EBI-25466446 URS0000811F6D_9606 EBI-25438148 URS0000811F6D_9606 lnc_arsr-1
URS000008DA94_9606-0 P07996 P07996
URS000008DA94_9606-2 P07996 P07996
URS000008DA94_9606-1 P60484 P60484

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    UAACACUGUCUGGUAACGAUGU

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 29 other species

    1. Alligator mississippiensis ami-miR-200a-3p
    2. Anolis carolinensis aca-miR-200a-3p
    3. Capra hircus miR-200a
    4. Chiloscyllium plagiosum microRNA cpl-miR-200a
    5. Danio rerio (zebrafish) dre-miR-200a-3p
    6. Equus caballus (horse) eca-miR-200a
    7. Gadus morhua gmo-miR-200a-3p
    8. Gallus gallus (chicken) gga-miR-200a-3p
    9. Gorilla gorilla (western gorilla) ggo-miR-200a
    10. Macaca mulatta mml-miR-200a-3p
    11. Monodelphis domestica mdo-miR-200a-3p
    12. Mus musculus (house mouse) mmu-miR-200a-3p
    13. Ovis aries miscellaneous RNA
    14. Pan troglodytes (chimpanzee) ptr-miR-200a
    15. Pongo pygmaeus ppy-miR-200a
    16. Rattus norvegicus rno-miR-200a-3p
    17. Takifugu rubripes (torafugu) fru-miR-200a
    18. Tetraodon nigroviridis tni-miR-200a
    19. Tor tambroides miR-200a-3p
    20. Xenopus tropicalis xtr-miR-200a