Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-146a-5p URS000050B527_9606

mRNA interactions 23 total

Genome locations

Gene Ontology annotations

Localisation

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGAGAACUGAAUUCCAUGGGUU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 20 other species

  1. Alligator mississippiensis (American alligator) Ami-Mir-146-P4_5p (mature (guide))
  2. Callithrix jacchus cja-miR-146a
  3. Canis lupus familiaris cfa-miR-146a
  4. Cervus elaphus (red deer) cel-miR-146a
  5. Cricetulus griseus (Chinese hamster) cgr-miR-146a
  6. Equus caballus eca-miR-146a
  7. Gallus gallus gga-miR-146a-5p
  8. Macaca mulatta mml-miR-146a-5p
  9. Microcebus murinus mmr-miR-146a
  10. Monodelphis domestica (gray short-tailed opossum) mdo-miR-146a-5p
  11. Mus musculus mmu-miR-146a-5p
  12. Nomascus leucogenys nle-miR-146a
  13. Pan troglodytes (chimpanzee) ptr-miR-146a
  14. Papio hamadryas (hamadryas baboon) pha-miR-146a
  15. Pongo pygmaeus (Bornean orangutan) ppy-miR-146a
  16. Pteropus alecto (black flying fox) pal-miR-146a-5p
  17. Rattus norvegicus rno-miR-146a-5p
  18. Sus scrofa ssc-miR-146a-5p
  19. Taeniopygia guttata tgu-miR-146c
  20. Tupaia chinensis (Chinese tree shrew) tch-miR-146a-5p
Publications