Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-146a-5p URS000050B527_9606

Automated summary: This miRNA sequence is 22 nucleotides long and is found in Homo sapiens. Annotated by 9 databases (PSICQUIC, TarBase, RefSeq, miRBase, GeneCards, MalaCards, MirGeneDB, ENA, LncBase). Homo sapiens (human) hsa-miR-146a-5p sequence is a product of hsa-miR-146a, 146, miR-146a, MIR146a, miR-146, miR-146a-5p, MIR146A, 146a, hsa-miR-146a-5p genes. Found in the human reference genome. Interacts with lncRNAs, such as (). Interacts with protein-coding genes, including 1-8D, 1-8U, 10-fTHF, 101F6, 103AS, 14.1, 15.212, 170A, 182-FIP, 18A2.

Interactions 35

According to PSICQUIC, Homo sapiens (human) hsa-miR-146a-5p interacts with:

Interaction id Participant Synonyms
URS000050B527_9606-0 O00206 O00206
URS000050B527_9606-20 O00206 O00206
URS000050B527_9606-1 O94916 O94916
URS000050B527_9606-21 O94916 O94916
URS000050B527_9606-2 P01111 P01111
URS000050B527_9606-22 P01111 P01111
URS000050B527_9606-24 P05231 P05231
URS000050B527_9606-23 P05231 P05231
URS000050B527_9606-3 P05231 P05231
URS000050B527_9606-4 P05231 P05231
URS000050B527_9606-5 P08603 P08603
URS000050B527_9606-25 P51617 P51617
URS000050B527_9606-6 P51617 P51617
URS000050B527_9606-8 P51617 P51617
URS000050B527_9606-7 P51617 P51617
URS000050B527_9606-26 P61586 P61586
URS000050B527_9606-9 P61586 P61586
URS000050B527_9606-27 P80075 P80075
URS000050B527_9606-10 P80075 P80075
URS000050B527_9606-18 P98164 P98164
URS000050B527_9606-28 P98164 P98164
URS000050B527_9606-29 Q13464 Q13464
URS000050B527_9606-19 Q13464 Q13464
URS000050B527_9606-30 Q15303 Q15303
URS000050B527_9606-11 Q15303 Q15303
URS000050B527_9606-12 Q96BA8 Q96BA8
URS000050B527_9606-31 Q96BA8 Q96BA8
URS000050B527_9606-13 Q9BWT7 Q9BWT7
URS000050B527_9606-14 Q9BX67 Q9BX67
URS000050B527_9606-32 Q9BX67 Q9BX67
URS000050B527_9606-33 Q9H4E5 Q9H4E5
URS000050B527_9606-15 Q9H4E5 Q9H4E5
URS000050B527_9606-17 Q9Y4K3 Q9Y4K3
URS000050B527_9606-16 Q9Y4K3 Q9Y4K3
URS000050B527_9606-34 Q9Y4K3 Q9Y4K3

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Localisation

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    Search for similar sequences
    UGAGAACUGAAUUCCAUGGGUU

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 20 other species

    1. Alligator mississippiensis Ami-Mir-146-P4_5p (mature (guide))
    2. Callithrix jacchus cja-miR-146a
    3. Canis lupus familiaris cfa-miR-146a
    4. Cervus elaphus (red deer) cel-miR-146a
    5. Cricetulus griseus cgr-miR-146a
    6. Equus caballus (horse) eca-miR-146a
    7. Gallus gallus (chicken) gga-miR-146a-5p
    8. Macaca mulatta (Rhesus monkey) mml-miR-146a-5p
    9. Microcebus murinus (gray mouse lemur) mmr-miR-146a
    10. Monodelphis domestica mdo-miR-146a-5p
    11. Mus musculus mmu-miR-146a-5p
    12. Nomascus leucogenys (northern white-cheeked gibbon) nle-miR-146a
    13. Pan troglodytes (chimpanzee) ptr-miR-146a
    14. Papio hamadryas pha-miR-146a
    15. Pongo pygmaeus ppy-miR-146a
    16. Pteropus alecto (black flying fox) pal-miR-146a-5p
    17. Rattus norvegicus rno-miR-146a-5p
    18. Sus scrofa (pig) ssc-miR-146a-5p
    19. Taeniopygia guttata tgu-miR-146c
    20. Tupaia chinensis tch-miR-146a-5p
    Publications New