Taeniopygia guttata (zebra finch) tgu-miR-146c URS000050B527_59729

• 22 nucleotides
• 2 databases (MIRBASE, RefSeq)
• Found in 21 other species
• 1 publications
• 1. sncRNA
  2. small regulatory ncRNA
  3. miRNA

mRNA interactions total

Genome locations

Gene Ontology annotations

Ancestor Chart

Loading ontology ancestors... Failed to load QuickGO Ancestor chart

×

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

{{ showSequence ? "Hide sequence" : "Show sequence" }}

Copy as RNA Copy as DNA

Search for similar sequences

UGAGAACUGAAUUCCAUGGGUU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 21 other species

1. Alligator mississippiensis (American alligator) Ami-Mir-146-P4_5p (mature (guide))
2. Callithrix jacchus (white-tufted-ear marmoset) cja-miR-146a
3. Canis lupus familiaris cfa-miR-146a
4. Cervus elaphus (red deer) cel-miR-146a
5. Cricetulus griseus cgr-miR-146a
6. Equus caballus (horse) eca-miR-146a
7. Gallus gallus (chicken) gga-miR-146a-5p
8. Homo sapiens (human) hsa-miR-146a-5p
9. Macaca mulatta (Rhesus monkey) mml-miR-146a-5p
10. Microcebus murinus mmr-miR-146a
11. Monodelphis domestica (gray short-tailed opossum) mdo-miR-146a-5p
12. Mus musculus (house mouse) mmu-miR-146a-5p
13. Nomascus leucogenys nle-miR-146a
14. Pan troglodytes (chimpanzee) ptr-miR-146a
15. Papio hamadryas (hamadryas baboon) pha-miR-146a
16. Pongo abelii (Sumatran orangutan) Pab-Mir-146-P4_5p (mature (guide))
17. Pongo pygmaeus (Bornean orangutan) ppy-miR-146a
18. Pteropus alecto pal-miR-146a-5p
19. Rattus norvegicus (Norway rat) rno-miR-146a-5p
20. Sus scrofa ssc-miR-146a-5p
21. Tupaia belangeri chinensis (Chinese tree shrew) tch-miR-146a-5p

Relationships

Molecular Relationships

Publications Download

• FASTA
• JSON