Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Canis lupus familiaris (dog) cfa-miR-146a URS000050B527_9615

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGAGAACUGAAUUCCAUGGGUU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 20 other species

  1. Alligator mississippiensis Ami-Mir-146-P4_5p (mature (guide))
  2. Callithrix jacchus (white-tufted-ear marmoset) cja-miR-146a
  3. Cervus elaphus (red deer) cel-miR-146a
  4. Cricetulus griseus (Chinese hamster) cgr-miR-146a
  5. Equus caballus eca-miR-146a
  6. Gallus gallus gga-miR-146a-5p
  7. Homo sapiens hsa-miR-146a-5p
  8. Macaca mulatta mml-miR-146a-5p
  9. Microcebus murinus (gray mouse lemur) mmr-miR-146a
  10. Monodelphis domestica mdo-miR-146a-5p
  11. Mus musculus (house mouse) mmu-miR-146a-5p
  12. Nomascus leucogenys (northern white-cheeked gibbon) nle-miR-146a
  13. Pan troglodytes ptr-miR-146a
  14. Papio hamadryas (hamadryas baboon) pha-miR-146a
  15. Pongo pygmaeus (Bornean orangutan) ppy-miR-146a
  16. Pteropus alecto pal-miR-146a-5p
  17. Rattus norvegicus (Norway rat) rno-miR-146a-5p
  18. Sus scrofa (pig) ssc-miR-146a-5p
  19. Taeniopygia guttata (zebra finch) tgu-miR-146c
  20. Tupaia chinensis tch-miR-146a-5p
Publications