Alligator mississippiensis (American alligator) Ami-Mir-146-P4_5p (mature (guide))

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Alligator mississippiensis (American alligator) Ami-Mir-146-P4_5p (mature (guide)) URS000050B527_8496

22 nucleotides
1 database (MirGeneDB)
Found in 21 other species

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

UGAGAACUGAAUUCCAUGGGUU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 21 other species

Callithrix jacchus cja-miR-146a
Canis lupus familiaris (dog) cfa-miR-146a
Cervus elaphus cel-miR-146a
Cricetulus griseus (Chinese hamster) cgr-miR-146a
Equus caballus eca-miR-146a
Gallus gallus gga-miR-146a-5p
Homo sapiens (human) hsa-miR-146a-5p
Macaca mulatta (Rhesus monkey) mml-miR-146a-5p
Microcebus murinus (gray mouse lemur) mmr-miR-146a
Monodelphis domestica (gray short-tailed opossum) mdo-miR-146a-5p
Mus musculus mmu-miR-146a-5p
Nomascus leucogenys (northern white-cheeked gibbon) nle-miR-146a
Pan troglodytes (chimpanzee) ptr-miR-146a
Papio hamadryas (hamadryas baboon) pha-miR-146a
Pongo abelii (Sumatran orangutan) Pab-Mir-146-P4_5p (mature (guide))
Pongo pygmaeus ppy-miR-146a
Pteropus alecto (black flying fox) pal-miR-146a-5p
Rattus norvegicus (Norway rat) rno-miR-146a-5p
Sus scrofa (pig) ssc-miR-146a-5p
Taeniopygia guttata tgu-miR-146c
Tupaia chinensis (Chinese tree shrew) tch-miR-146a-5p

Relationships