Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Gallus gallus (chicken) gga-miR-146a-5p URS000050B527_9031

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

gga-mir-146a: Gga-mir-146a is a differentially expressed miRNA that has been associated with virus infection in both broiler and layer chickens [PMC3496578]. It is one of the miRNAs that are up-regulated after avian influenza virus infection [PMC5389138]. Gga-mir-146a has been found to be involved in the regulation of 3T3-L1 differentiation and adipocyte differentiation [PMC6826404]. It has also been shown to target ESRP2 genes, potentially influencing the postnatal liver maturation process [PMC5758705]. In addition, gga-mir-146a is one of the miRNAs that are up-regulated in CD40L-stimulated B cells, indicating its role in the immune system [PMC3743212]. The expression of gga-mir-146a can be validated using a dual luciferase reporter assay and qPCR [PMC3496578] [PMC8633681]. However, it is not predicted to target chicken IL-2 [PMC2873332]. Overall, gga-mir-146a is a differentially expressed miRNA with potential roles in virus infection, adipocyte differentiation, liver maturation process, and immune system regulation.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGAGAACUGAAUUCCAUGGGUU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 20 other species

  1. Alligator mississippiensis Ami-Mir-146-P4_5p (mature (guide))
  2. Callithrix jacchus (white-tufted-ear marmoset) cja-miR-146a
  3. Canis lupus familiaris (dog) cfa-miR-146a
  4. Cervus elaphus (red deer) cel-miR-146a
  5. Cricetulus griseus (Chinese hamster) cgr-miR-146a
  6. Equus caballus eca-miR-146a
  7. Homo sapiens hsa-miR-146a-5p
  8. Macaca mulatta mml-miR-146a-5p
  9. Microcebus murinus (gray mouse lemur) mmr-miR-146a
  10. Monodelphis domestica mdo-miR-146a-5p
  11. Mus musculus (house mouse) mmu-miR-146a-5p
  12. Nomascus leucogenys (northern white-cheeked gibbon) nle-miR-146a
  13. Pan troglodytes ptr-miR-146a
  14. Papio hamadryas (hamadryas baboon) pha-miR-146a
  15. Pongo pygmaeus (Bornean orangutan) ppy-miR-146a
  16. Pteropus alecto pal-miR-146a-5p
  17. Rattus norvegicus (Norway rat) rno-miR-146a-5p
  18. Sus scrofa (pig) ssc-miR-146a-5p
  19. Taeniopygia guttata (zebra finch) tgu-miR-146c
  20. Tupaia chinensis tch-miR-146a-5p
Publications