v26

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Papio hamadryas (hamadryas baboon) pha-miR-146a URS000050B527_9557

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
UGAGAACUGAAUUCCAUGGGUU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 21 other species

  1. Alligator mississippiensis (American alligator) Ami-Mir-146-P4_5p (mature (guide))
  2. Callithrix jacchus cja-miR-146a
  3. Canis lupus familiaris (dog) cfa-miR-146a
  4. Cervus elaphus cel-miR-146a
  5. Cricetulus griseus (Chinese hamster) cgr-miR-146a
  6. Equus caballus eca-miR-146a
  7. Gallus gallus gga-miR-146a-5p
  8. Homo sapiens (human) hsa-miR-146a-5p
  9. Macaca mulatta (Rhesus monkey) mml-miR-146a-5p
  10. Microcebus murinus (gray mouse lemur) mmr-miR-146a
  11. Monodelphis domestica (gray short-tailed opossum) mdo-miR-146a-5p
  12. Mus musculus mmu-miR-146a-5p
  13. Nomascus leucogenys (northern white-cheeked gibbon) nle-miR-146a
  14. Pan troglodytes (chimpanzee) ptr-miR-146a
  15. Pongo abelii (Sumatran orangutan) Pab-Mir-146-P4_5p (mature (guide))
  16. Pongo pygmaeus ppy-miR-146a
  17. Pteropus alecto (black flying fox) pal-miR-146a-5p
  18. Rattus norvegicus (Norway rat) rno-miR-146a-5p
  19. Sus scrofa (pig) ssc-miR-146a-5p
  20. Taeniopygia guttata tgu-miR-146c
  21. Tupaia chinensis (Chinese tree shrew) tch-miR-146a-5p
 Relationships

Molecular Relationships