Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Tupaia chinensis (Chinese tree shrew) tch-miR-146a-5p URS000050B527_246437

mRNA interactions total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGAGAACUGAAUUCCAUGGGUU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 21 other species

  1. Alligator mississippiensis (American alligator) Ami-Mir-146-P4_5p (mature (guide))
  2. Callithrix jacchus (white-tufted-ear marmoset) cja-miR-146a
  3. Canis lupus familiaris cfa-miR-146a
  4. Cervus elaphus (red deer) cel-miR-146a
  5. Cricetulus griseus cgr-miR-146a
  6. Equus caballus (horse) eca-miR-146a
  7. Gallus gallus (chicken) gga-miR-146a-5p
  8. Homo sapiens (human) hsa-miR-146a-5p
  9. Macaca mulatta (Rhesus monkey) mml-miR-146a-5p
  10. Microcebus murinus mmr-miR-146a
  11. Monodelphis domestica (gray short-tailed opossum) mdo-miR-146a-5p
  12. Mus musculus (house mouse) mmu-miR-146a-5p
  13. Nomascus leucogenys nle-miR-146a
  14. Pan troglodytes (chimpanzee) ptr-miR-146a
  15. Papio hamadryas (hamadryas baboon) pha-miR-146a
  16. Pongo abelii (Sumatran orangutan) Pab-Mir-146-P4_5p (mature (guide))
  17. Pongo pygmaeus (Bornean orangutan) ppy-miR-146a
  18. Pteropus alecto pal-miR-146a-5p
  19. Rattus norvegicus (Norway rat) rno-miR-146a-5p
  20. Sus scrofa ssc-miR-146a-5p
  21. Taeniopygia guttata (zebra finch) tgu-miR-146c
Relationships

Molecular Relationships

Publications