Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Mus musculus (house mouse) mmu-miR-146a-5p URS000050B527_10090

Automated summary: This miRNA sequence is 22 nucleotides long and is found in Mus musculus. Annotated by 6 databases (TarBase, PirBase, miRBase, LncBase, RefSeq, ENA). Mus musculus (house mouse) mmu-miR-146a-5p sequence is a product of mmu-miR-146a-5p, miR-146a, miR-146a-5p, Mir146, mmu-miR-146a, miR-146 genes. Found in the house mouse reference genome. Interacts with lncRNAs, such as (). Interacts with protein-coding genes, including 0610006F02Rik, 0610007L01Rik, 0610007L03Rik, 0610009O20Rik, 0610010C04Rik, 0610038P07Rik, 0610039N19Rik, 0710001F19Rik, 0710008A13Rik, 0710008K06Rik.

Interactions 2

According to PSICQUIC, Mus musculus (house mouse) mmu-miR-146a-5p interacts with:

Interaction id Participant Synonyms
URS000050B527_10090-0 P53351 P53351
URS000050B527_10090-1 P53351 P53351

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Localisation

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    Search for similar sequences
    UGAGAACUGAAUUCCAUGGGUU

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 20 other species

    1. Alligator mississippiensis Ami-Mir-146-P4_5p (mature (guide))
    2. Callithrix jacchus cja-miR-146a
    3. Canis lupus familiaris cfa-miR-146a
    4. Cervus elaphus (red deer) cel-miR-146a
    5. Cricetulus griseus (Chinese hamster) cgr-miR-146a
    6. Equus caballus (horse) eca-miR-146a
    7. Gallus gallus gga-miR-146a-5p
    8. Homo sapiens (human) hsa-miR-146a-5p
    9. Macaca mulatta mml-miR-146a-5p
    10. Microcebus murinus mmr-miR-146a
    11. Monodelphis domestica (gray short-tailed opossum) mdo-miR-146a-5p
    12. Nomascus leucogenys nle-miR-146a
    13. Pan troglodytes ptr-miR-146a
    14. Papio hamadryas pha-miR-146a
    15. Pongo pygmaeus ppy-miR-146a
    16. Pteropus alecto (black flying fox) pal-miR-146a-5p
    17. Rattus norvegicus (Norway rat) rno-miR-146a-5p
    18. Sus scrofa (pig) ssc-miR-146a-5p
    19. Taeniopygia guttata tgu-miR-146c
    20. Tupaia chinensis (Chinese tree shrew) tch-miR-146a-5p
    Publications New