Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Sus scrofa (pig) ssc-miR-148a-3p URS00003BBF48_9823

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

ssc-mir-148a: Ssc-mir-148a is a microRNA that has been studied in various contexts [PMC6966835]. It has been found to be highly expressed and differentially expressed in different conditions [PMC3427155]. In a study comparing miRNA expression in pigs susceptible and resistant to E. coli F18 infection, ssc-mir-148a was identified as one of the miRNAs with differential expression, being upregulated in susceptible animals [PMC3427155]. Another study found that ssc-mir-148a was highly expressed in the longissimus muscles [PMC3528764]. In the context of skeletal muscle development, ssc-mir-148a was one of the most abundant miRNAs during porcine skeletal muscle developmental stages [PMC5536276]. It has also been implicated in myogenesis, with its expression levels being higher during myogenesis promotion [PMC4423774]. Additionally, ssc-mir-148a has been identified as a candidate disease marker in the duodenum of E. coli F18-sensitive and -resistant weaned piglets [PMC4585011]. Overall, ssc-mir-148a is a microRNA that is involved in various biological processes and has been studied extensively.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UCAGUGCACUACAGAACUUUGU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 38 other species

  1. Anolis carolinensis aca-miR-148a-3p
  2. Bos taurus (cattle) bta-miR-148a
  3. Callithrix jacchus (white-tufted-ear marmoset) cja-miR-148a
  4. Callorhinchus milii Cmi-Mir-148-P1_3p (mature (guide))
  5. Canis lupus familiaris cfa-miR-148a
  6. Capra hircus (goat) chi-miR-148a-3p
  7. Cavia porcellus (domestic guinea pig) cpo-miR-148a-3p
  8. Cervus elaphus cel-miR-148a
  9. Chrysemys picta bellii (western painted turtle) Cpi-Mir-148-P1_3p (mature (guide))
  10. Chrysemys picta cpi-miR-148a-3p
  11. Columba livia (rock pigeon) cli-miR-148a-3p
  12. Cricetulus griseus (Chinese hamster) cgr-miR-148a
  13. Dasypus novemcinctus (nine-banded armadillo) dno-miR-148a-3p
  14. Echinops telfairi Ete-Mir-148-P1_3p (mature (guide))
  15. Equus caballus eca-miR-148a
  16. Gallus gallus (chicken) gga-miR-148a-3p
  17. Gekko japonicus Gja-Mir-148-P1_3p (mature (guide))
  18. Homo sapiens hsa-miR-148a-3p
  19. Latimeria chalumnae Lch-Mir-148-P1_3p (mature (guide))
  20. Macaca mulatta mml-miR-148a-3p
  21. Microcaecilia unicolor Mun-Mir-148-P1_3p (mature (guide))
  22. Monodelphis domestica mdo-miR-148-3p
  23. Mus musculus (house mouse) mmu-miR-148a-3p
  24. Ornithorhynchus anatinus oan-miR-148-3p
  25. Oryctolagus cuniculus ocu-miR-148a-3p
  26. Ovis aries oar-miR-148a
  27. Pan troglodytes (chimpanzee) ptr-miR-148a
  28. Pongo pygmaeus (Bornean orangutan) ppy-miR-148a
  29. Pteropus alecto (black flying fox) pal-miR-148a-3p
  30. Python bivittatus pbv-miR-148a-3p
  31. Rattus norvegicus Rno-Mir-148-P1_3p (mature (guide))
  32. Saimiri boliviensis boliviensis sbo-miR-148a
  33. Scyliorhinus torazame (cloudy catshark) Sto-Mir-148-P1_3p (mature (guide))
  34. Sphenodon punctatus Spt-Mir-148-P1_3p (mature (guide))
  35. Taeniopygia guttata (zebra finch) tgu-miR-148a-3p
  36. Tupaia chinensis tch-miR-148a-3p
  37. Xenopus laevis (African clawed frog) Xla-Mir-148-P1b_3p (mature (guide))
  38. Xenopus tropicalis xtr-miR-148a
Publications