Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Microcaecilia unicolor Mun-Mir-148-P1_3p (mature (guide)) URS00003BBF48_1415580

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UCAGUGCACUACAGAACUUUGU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 38 other species

  1. Anolis carolinensis aca-miR-148a-3p
  2. Bos taurus (cattle) bta-miR-148a
  3. Callithrix jacchus (white-tufted-ear marmoset) cja-miR-148a
  4. Callorhinchus milii Cmi-Mir-148-P1_3p (mature (guide))
  5. Canis lupus familiaris cfa-miR-148a
  6. Capra hircus (goat) chi-miR-148a-3p
  7. Cavia porcellus (domestic guinea pig) cpo-miR-148a-3p
  8. Cervus elaphus cel-miR-148a
  9. Chrysemys picta bellii (western painted turtle) Cpi-Mir-148-P1_3p (mature (guide))
  10. Chrysemys picta cpi-miR-148a-3p
  11. Columba livia (rock pigeon) cli-miR-148a-3p
  12. Cricetulus griseus (Chinese hamster) cgr-miR-148a
  13. Dasypus novemcinctus (nine-banded armadillo) dno-miR-148a-3p
  14. Echinops telfairi Ete-Mir-148-P1_3p (mature (guide))
  15. Equus caballus eca-miR-148a
  16. Gallus gallus (chicken) gga-miR-148a-3p
  17. Gekko japonicus Gja-Mir-148-P1_3p (mature (guide))
  18. Homo sapiens hsa-miR-148a-3p
  19. Latimeria chalumnae Lch-Mir-148-P1_3p (mature (guide))
  20. Macaca mulatta mml-miR-148a-3p
  21. Monodelphis domestica mdo-miR-148-3p
  22. Mus musculus (house mouse) mmu-miR-148a-3p
  23. Ornithorhynchus anatinus oan-miR-148-3p
  24. Oryctolagus cuniculus ocu-miR-148a-3p
  25. Ovis aries oar-miR-148a
  26. Pan troglodytes (chimpanzee) ptr-miR-148a
  27. Pongo pygmaeus (Bornean orangutan) ppy-miR-148a
  28. Pteropus alecto (black flying fox) pal-miR-148a-3p
  29. Python bivittatus pbv-miR-148a-3p
  30. Rattus norvegicus Rno-Mir-148-P1_3p (mature (guide))
  31. Saimiri boliviensis boliviensis sbo-miR-148a
  32. Scyliorhinus torazame (cloudy catshark) Sto-Mir-148-P1_3p (mature (guide))
  33. Sphenodon punctatus Spt-Mir-148-P1_3p (mature (guide))
  34. Sus scrofa (pig) ssc-miR-148a-3p
  35. Taeniopygia guttata (zebra finch) tgu-miR-148a-3p
  36. Tupaia chinensis tch-miR-148a-3p
  37. Xenopus laevis (African clawed frog) Xla-Mir-148-P1b_3p (mature (guide))
  38. Xenopus tropicalis xtr-miR-148a