Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Canis lupus familiaris (dog) cfa-miR-148a URS00003BBF48_9615

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

cfa-mir-148a: Cfa-mir-148a is a microRNA that has been studied in various contexts. In a study of mammary tumors, ten microRNAs, including cfa-mir-148a, were found to have significantly different expression in metastatic and non-metastatic tumors [PMC7646326]. Another study selected ten microRNAs, including cfa-mir-148a, to validate microarray results [PMC5678797]. In the context of cryptorchidism and male infertility in dogs, cfa-mir-148a was found to have consistently lower expression in the testes of dogs with cryptorchidism [PMC10135127]. Additionally, the expression of cfa-mir-148a was downregulated in the testes of cryptorchid dogs compared to age-matched normal dogs [PMC10135127]. Furthermore, cfa-miR-497 and cfa-miR-1841 were also found to have lower expression in the testes and epididymis respectively [PMC10135127]. According to the miRBase Sequence Database, cfa-mir-148a is encoded on chromosome 14 and has complete homology between mice and humans [PMC9888699]. These findings suggest that cfa-mir-148a may be a useful biomarker for various conditions such as mammary tumors and cryptorchidism.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UCAGUGCACUACAGAACUUUGU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 38 other species

  1. Anolis carolinensis aca-miR-148a-3p
  2. Bos taurus (cattle) bta-miR-148a
  3. Callithrix jacchus (white-tufted-ear marmoset) cja-miR-148a
  4. Callorhinchus milii Cmi-Mir-148-P1_3p (mature (guide))
  5. Capra hircus (goat) chi-miR-148a-3p
  6. Cavia porcellus (domestic guinea pig) cpo-miR-148a-3p
  7. Cervus elaphus cel-miR-148a
  8. Chrysemys picta bellii (western painted turtle) Cpi-Mir-148-P1_3p (mature (guide))
  9. Chrysemys picta cpi-miR-148a-3p
  10. Columba livia (rock pigeon) cli-miR-148a-3p
  11. Cricetulus griseus (Chinese hamster) cgr-miR-148a
  12. Dasypus novemcinctus (nine-banded armadillo) dno-miR-148a-3p
  13. Echinops telfairi Ete-Mir-148-P1_3p (mature (guide))
  14. Equus caballus eca-miR-148a
  15. Gallus gallus (chicken) gga-miR-148a-3p
  16. Gekko japonicus Gja-Mir-148-P1_3p (mature (guide))
  17. Homo sapiens hsa-miR-148a-3p
  18. Latimeria chalumnae Lch-Mir-148-P1_3p (mature (guide))
  19. Macaca mulatta mml-miR-148a-3p
  20. Microcaecilia unicolor Mun-Mir-148-P1_3p (mature (guide))
  21. Monodelphis domestica mdo-miR-148-3p
  22. Mus musculus (house mouse) mmu-miR-148a-3p
  23. Ornithorhynchus anatinus oan-miR-148-3p
  24. Oryctolagus cuniculus ocu-miR-148a-3p
  25. Ovis aries oar-miR-148a
  26. Pan troglodytes (chimpanzee) ptr-miR-148a
  27. Pongo pygmaeus (Bornean orangutan) ppy-miR-148a
  28. Pteropus alecto (black flying fox) pal-miR-148a-3p
  29. Python bivittatus pbv-miR-148a-3p
  30. Rattus norvegicus Rno-Mir-148-P1_3p (mature (guide))
  31. Saimiri boliviensis boliviensis sbo-miR-148a
  32. Scyliorhinus torazame (cloudy catshark) Sto-Mir-148-P1_3p (mature (guide))
  33. Sphenodon punctatus Spt-Mir-148-P1_3p (mature (guide))
  34. Sus scrofa (pig) ssc-miR-148a-3p
  35. Taeniopygia guttata (zebra finch) tgu-miR-148a-3p
  36. Tupaia chinensis tch-miR-148a-3p
  37. Xenopus laevis (African clawed frog) Xla-Mir-148-P1b_3p (mature (guide))
  38. Xenopus tropicalis xtr-miR-148a
Publications