Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Ovis aries (sheep) oar-miR-148a URS00003BBF48_9940

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

oar-mir-148a: Oar-mir-148a is a highly expressed miRNA that has been shown to play important roles in regulating GnRH release [PMC6974689]. It is part of a network of miRNAs, including oar-miR-379-5p, oar-miR-495-3p, oar-miR-143, oar-miR-106b, and oar-miR-218a, that co-regulate thyrotropin-releasing hormone (TRH) in the hypothalamus [PMC9222358]. These miRNAs and TRH have been implicated in the release of GnRH [PMC9222358]. Oar-mir-148a is highly expressed in the ovaries of various animal species, including goats, pigs, mice, and cattle [PMC7971002]. It is also associated with cellular differentiation and development [PMC9205095]. Oar-mir-148a has been found to be differentially expressed between seronegative and infected sheep and may have implications for host-virus interactions [PMC6339376]. In sheep with adrenal gland tumors (MM sheep), oar-mir-148a is upregulated along with other miRNAs such as oar-let7i and oar-let7g [PMC9205095]. The upregulated expression of oar-mir-148a has been validated through qPCR experiments [PMC6339376]. Overall, Oar-mir-148a appears to be a highly expressed miRNA that plays important roles in regulating GnRH release as well as cellular differentiation and development. It may also have implications for host-virus interactions.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UCAGUGCACUACAGAACUUUGU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 38 other species

  1. Anolis carolinensis aca-miR-148a-3p
  2. Bos taurus (cattle) bta-miR-148a
  3. Callithrix jacchus (white-tufted-ear marmoset) cja-miR-148a
  4. Callorhinchus milii Cmi-Mir-148-P1_3p (mature (guide))
  5. Canis lupus familiaris cfa-miR-148a
  6. Capra hircus (goat) chi-miR-148a-3p
  7. Cavia porcellus (domestic guinea pig) cpo-miR-148a-3p
  8. Cervus elaphus cel-miR-148a
  9. Chrysemys picta bellii (western painted turtle) Cpi-Mir-148-P1_3p (mature (guide))
  10. Chrysemys picta cpi-miR-148a-3p
  11. Columba livia (rock pigeon) cli-miR-148a-3p
  12. Cricetulus griseus (Chinese hamster) cgr-miR-148a
  13. Dasypus novemcinctus (nine-banded armadillo) dno-miR-148a-3p
  14. Echinops telfairi Ete-Mir-148-P1_3p (mature (guide))
  15. Equus caballus eca-miR-148a
  16. Gallus gallus (chicken) gga-miR-148a-3p
  17. Gekko japonicus Gja-Mir-148-P1_3p (mature (guide))
  18. Homo sapiens hsa-miR-148a-3p
  19. Latimeria chalumnae Lch-Mir-148-P1_3p (mature (guide))
  20. Macaca mulatta mml-miR-148a-3p
  21. Microcaecilia unicolor Mun-Mir-148-P1_3p (mature (guide))
  22. Monodelphis domestica mdo-miR-148-3p
  23. Mus musculus (house mouse) mmu-miR-148a-3p
  24. Ornithorhynchus anatinus oan-miR-148-3p
  25. Oryctolagus cuniculus ocu-miR-148a-3p
  26. Pan troglodytes (chimpanzee) ptr-miR-148a
  27. Pongo pygmaeus (Bornean orangutan) ppy-miR-148a
  28. Pteropus alecto (black flying fox) pal-miR-148a-3p
  29. Python bivittatus pbv-miR-148a-3p
  30. Rattus norvegicus Rno-Mir-148-P1_3p (mature (guide))
  31. Saimiri boliviensis boliviensis sbo-miR-148a
  32. Scyliorhinus torazame (cloudy catshark) Sto-Mir-148-P1_3p (mature (guide))
  33. Sphenodon punctatus Spt-Mir-148-P1_3p (mature (guide))
  34. Sus scrofa (pig) ssc-miR-148a-3p
  35. Taeniopygia guttata (zebra finch) tgu-miR-148a-3p
  36. Tupaia chinensis tch-miR-148a-3p
  37. Xenopus laevis (African clawed frog) Xla-Mir-148-P1b_3p (mature (guide))
  38. Xenopus tropicalis xtr-miR-148a
Publications