Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Mus musculus (house mouse) mmu-miR-148a-3p URS00003BBF48_10090

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

mmu-mir-148a: mmu-mir-148a, a microRNA, was knocked out in C57BL/6 J mice using CRISPR/Cas9 technology [PMC9708754]. In a study, fifteen microRNAs, including mmu-mir-148a, were examined [PMC4849059]. Intravenous administration of AAV9 vectors expressing either mmu-mir-148a or an empty control vector was performed [PMC6403487]. The expression of mmu-mir-148a was found to be largely restricted to 10.5 dpc and constituted 16.07% of all miRNAs at that time [PMC1635289]. It was also found to be profuse in sequencing libraries of other animal gonads [PMC4499447]. Furthermore, mmu-miR-375 and mmu-mir-148a were identified as mouse pancreatic β cell-specific miRNAs [PMC7016162]. Among all known mouse miRNAs, 173 known miRNAs were differentially expressed in β cells compared with other cells, including islet-specific miRNA (miR-375) and miR-148a [PMC7016162]. The levels of mmu-miR-375 and mmu-mir-148a in mouse pancreatic β cells were significantly higher than in other cells according to NGS data [PMC7016162].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UCAGUGCACUACAGAACUUUGU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 38 other species

  1. Anolis carolinensis aca-miR-148a-3p
  2. Bos taurus (cattle) bta-miR-148a
  3. Callithrix jacchus (white-tufted-ear marmoset) cja-miR-148a
  4. Callorhinchus milii Cmi-Mir-148-P1_3p (mature (guide))
  5. Canis lupus familiaris cfa-miR-148a
  6. Capra hircus (goat) chi-miR-148a-3p
  7. Cavia porcellus (domestic guinea pig) cpo-miR-148a-3p
  8. Cervus elaphus cel-miR-148a
  9. Chrysemys picta bellii (western painted turtle) Cpi-Mir-148-P1_3p (mature (guide))
  10. Chrysemys picta cpi-miR-148a-3p
  11. Columba livia (rock pigeon) cli-miR-148a-3p
  12. Cricetulus griseus (Chinese hamster) cgr-miR-148a
  13. Dasypus novemcinctus (nine-banded armadillo) dno-miR-148a-3p
  14. Echinops telfairi Ete-Mir-148-P1_3p (mature (guide))
  15. Equus caballus eca-miR-148a
  16. Gallus gallus (chicken) gga-miR-148a-3p
  17. Gekko japonicus Gja-Mir-148-P1_3p (mature (guide))
  18. Homo sapiens hsa-miR-148a-3p
  19. Latimeria chalumnae Lch-Mir-148-P1_3p (mature (guide))
  20. Macaca mulatta mml-miR-148a-3p
  21. Microcaecilia unicolor Mun-Mir-148-P1_3p (mature (guide))
  22. Monodelphis domestica mdo-miR-148-3p
  23. Ornithorhynchus anatinus oan-miR-148-3p
  24. Oryctolagus cuniculus ocu-miR-148a-3p
  25. Ovis aries oar-miR-148a
  26. Pan troglodytes (chimpanzee) ptr-miR-148a
  27. Pongo pygmaeus (Bornean orangutan) ppy-miR-148a
  28. Pteropus alecto (black flying fox) pal-miR-148a-3p
  29. Python bivittatus pbv-miR-148a-3p
  30. Rattus norvegicus Rno-Mir-148-P1_3p (mature (guide))
  31. Saimiri boliviensis boliviensis sbo-miR-148a
  32. Scyliorhinus torazame (cloudy catshark) Sto-Mir-148-P1_3p (mature (guide))
  33. Sphenodon punctatus Spt-Mir-148-P1_3p (mature (guide))
  34. Sus scrofa (pig) ssc-miR-148a-3p
  35. Taeniopygia guttata (zebra finch) tgu-miR-148a-3p
  36. Tupaia chinensis tch-miR-148a-3p
  37. Xenopus laevis (African clawed frog) Xla-Mir-148-P1b_3p (mature (guide))
  38. Xenopus tropicalis xtr-miR-148a
Publications