Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Gallus gallus (chicken) gga-miR-148a-3p URS00003BBF48_9031

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

gga-mir-148a: Gga-mir-148a is a chicken miRNA that is expressed at a high level in IAH30 cells, as well as in chicken hepatocytes and ovarian RNA libraries [PMC3743212] [PMC3526641] [PMC4326283]. It is one of the dominant miRNAs expressed in the chicken ovary and has been shown to play a role in cell proliferation, apoptosis, and ovarian steroidogenesis [PMC5940789]. Gga-mir-148a has also been found to be more abundant in the lean line of chickens compared to the fat line [PMC4326283]. It interacts with the SOCS3 gene and is involved in the response to Campylobacter jejuni inoculation [PMC7248314]. Additionally, gga-mir-148a displays increased H3K4me3 marks in infected birds from the resistant line at 10 dpi [PMC4404578]. The expression of gga-mir-148a has been confirmed through qRT-PCR analysis, which aligns with sequencing data [PMC4735322]. However, despite its high expression levels and potential roles in various biological processes, research on gga-mir-148a is still limited in chickens [PMC7769946]. Further investigation is needed to determine whether gga-mir-148a can reduce tumor incidence by inhibiting cell proliferation and cycle.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UCAGUGCACUACAGAACUUUGU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 38 other species

  1. Anolis carolinensis aca-miR-148a-3p
  2. Bos taurus (cattle) bta-miR-148a
  3. Callithrix jacchus (white-tufted-ear marmoset) cja-miR-148a
  4. Callorhinchus milii Cmi-Mir-148-P1_3p (mature (guide))
  5. Canis lupus familiaris cfa-miR-148a
  6. Capra hircus (goat) chi-miR-148a-3p
  7. Cavia porcellus (domestic guinea pig) cpo-miR-148a-3p
  8. Cervus elaphus cel-miR-148a
  9. Chrysemys picta bellii (western painted turtle) Cpi-Mir-148-P1_3p (mature (guide))
  10. Chrysemys picta cpi-miR-148a-3p
  11. Columba livia (rock pigeon) cli-miR-148a-3p
  12. Cricetulus griseus (Chinese hamster) cgr-miR-148a
  13. Dasypus novemcinctus (nine-banded armadillo) dno-miR-148a-3p
  14. Echinops telfairi Ete-Mir-148-P1_3p (mature (guide))
  15. Equus caballus eca-miR-148a
  16. Gekko japonicus Gja-Mir-148-P1_3p (mature (guide))
  17. Homo sapiens hsa-miR-148a-3p
  18. Latimeria chalumnae Lch-Mir-148-P1_3p (mature (guide))
  19. Macaca mulatta mml-miR-148a-3p
  20. Microcaecilia unicolor Mun-Mir-148-P1_3p (mature (guide))
  21. Monodelphis domestica mdo-miR-148-3p
  22. Mus musculus (house mouse) mmu-miR-148a-3p
  23. Ornithorhynchus anatinus oan-miR-148-3p
  24. Oryctolagus cuniculus ocu-miR-148a-3p
  25. Ovis aries oar-miR-148a
  26. Pan troglodytes (chimpanzee) ptr-miR-148a
  27. Pongo pygmaeus (Bornean orangutan) ppy-miR-148a
  28. Pteropus alecto (black flying fox) pal-miR-148a-3p
  29. Python bivittatus pbv-miR-148a-3p
  30. Rattus norvegicus Rno-Mir-148-P1_3p (mature (guide))
  31. Saimiri boliviensis boliviensis sbo-miR-148a
  32. Scyliorhinus torazame (cloudy catshark) Sto-Mir-148-P1_3p (mature (guide))
  33. Sphenodon punctatus Spt-Mir-148-P1_3p (mature (guide))
  34. Sus scrofa (pig) ssc-miR-148a-3p
  35. Taeniopygia guttata (zebra finch) tgu-miR-148a-3p
  36. Tupaia chinensis tch-miR-148a-3p
  37. Xenopus laevis (African clawed frog) Xla-Mir-148-P1b_3p (mature (guide))
  38. Xenopus tropicalis xtr-miR-148a
Publications