Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Rattus norvegicus (Norway rat) rno-miR-150-5p URS000016FD1A_10116

mRNA interactions 1 total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UCUCCCAACCCUUGUACCAGUG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 28 other species

  1. Alligator mississippiensis ami-miR-150-5p
  2. Anolis carolinensis aca-miR-150-5p
  3. Bos taurus (cattle) Bta-Mir-150_5p (mature (guide))
  4. Callithrix jacchus cja-miR-150
  5. Callorhinchus milii Cmi-Mir-150_5p (mature (guide))
  6. Canis lupus familiaris cfa-miR-150
  7. Capra hircus (goat) chi-miR-150
  8. Cavia porcellus cpo-miR-150-5p
  9. Cervus elaphus (red deer) cel-miR-150
  10. Cricetulus griseus (Chinese hamster) cgr-miR-150
  11. Dasypus novemcinctus (nine-banded armadillo) dno-miR-150-5p
  12. Echinops telfairi Ete-Mir-150_5p (mature (guide))
  13. Equus caballus (horse) eca-miR-150
  14. Gekko japonicus Gja-Mir-150_5p (mature (guide))
  15. Gorilla gorilla gorilla ggo-miR-150 (MIR150)
  16. Gorilla gorilla ggo-miR-150
  17. Homo sapiens (human) hsa-miR-150-5p
  18. Macaca mulatta (Rhesus monkey) mml-miR-150-5p
  19. Microcaecilia unicolor Mun-Mir-150_5p (mature (guide))
  20. Mus musculus (house mouse) mmu-miR-150-5p
  21. Ovis aries oar-miR-150
  22. Pan troglodytes ptr-miR-150
  23. Pongo pygmaeus ppy-miR-150
  24. Python bivittatus pbv-miR-150-5p
  25. Scyliorhinus torazame (cloudy catshark) Sto-Mir-150_5p (mature (guide))
  26. Sphenodon punctatus (tuatara) Spt-Mir-150_5p (mature (guide))
  27. Sus scrofa ssc-miR-150
  28. Tursiops truncatus miR-150
Publications