Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Mus musculus (house mouse) mmu-miR-150-5p URS000016FD1A_10090

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

mmu-mir-150: Mmu-mir-150 is a microRNA that has been found to be upregulated in various studies [PMC4062425] [PMC6829453] [PMC6206094]. It has been shown to influence multiple stages in various immune cells, making it a good candidate for drug development [PMC6829453]. Mmu-mir-150, along with mmu-miR-15/16, assists in the maturation of iNKs into mNKs by targeting the same gene, c-Myb [PMC6829453]. It has also been found to promote the differentiation of pre-NKs into iNKs by targeting c-Myb or the Notch signaling inhibitor Nemo-like kinase (NLK) [PMC6829453]. Mmu-mir-150 is involved in the activation of mature NK cells and suppresses IFN-γ production in CD56bright NK cells [PMC6829453]. Additionally, mmu-mir-150 has been studied for its role in adipogenic differentiation and immune evasion [PMC6875317] [PMC4114167]. It is also downregulated during alcohol treatment and upregulated during M. bovis BCG infection and SA1 infection [PMC6206094] [PMC4097432] [PMC4114167]. Mmu-mir-150 has been shown to be involved in lymphoid development and is dysregulated in various cell types including B lymphocytes, CD8+ T cells, and megakaryocytes. It also plays a role in retinal pathological angiogenesis and monocytic lineage with age. The expression of mmu-mir-150 can be manipulated through gain-of-function experiments or gene deletion studies using mice models.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UCUCCCAACCCUUGUACCAGUG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 28 other species

  1. Alligator mississippiensis ami-miR-150-5p
  2. Anolis carolinensis aca-miR-150-5p
  3. Bos taurus (cattle) Bta-Mir-150_5p (mature (guide))
  4. Callithrix jacchus cja-miR-150
  5. Callorhinchus milii Cmi-Mir-150_5p (mature (guide))
  6. Canis lupus familiaris cfa-miR-150
  7. Capra hircus (goat) chi-miR-150
  8. Cavia porcellus cpo-miR-150-5p
  9. Cervus elaphus (red deer) cel-miR-150
  10. Cricetulus griseus (Chinese hamster) cgr-miR-150
  11. Dasypus novemcinctus (nine-banded armadillo) dno-miR-150-5p
  12. Echinops telfairi Ete-Mir-150_5p (mature (guide))
  13. Equus caballus (horse) eca-miR-150
  14. Gekko japonicus Gja-Mir-150_5p (mature (guide))
  15. Gorilla gorilla gorilla ggo-miR-150 (MIR150)
  16. Gorilla gorilla ggo-miR-150
  17. Homo sapiens (human) hsa-miR-150-5p
  18. Macaca mulatta (Rhesus monkey) mml-miR-150-5p
  19. Microcaecilia unicolor Mun-Mir-150_5p (mature (guide))
  20. Ovis aries oar-miR-150
  21. Pan troglodytes ptr-miR-150
  22. Pongo pygmaeus ppy-miR-150
  23. Python bivittatus pbv-miR-150-5p
  24. Rattus norvegicus rno-miR-150-5p
  25. Scyliorhinus torazame (cloudy catshark) Sto-Mir-150_5p (mature (guide))
  26. Sphenodon punctatus (tuatara) Spt-Mir-150_5p (mature (guide))
  27. Sus scrofa ssc-miR-150
  28. Tursiops truncatus miR-150
Publications