Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Capra hircus (goat) chi-miR-150 URS000016FD1A_9925

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

chi-mir-150: Chi-mir-150 is one of the top nine miRNAs identified in the study [PMC8784682]. It has been found to target FGFR1, which is important for FGF-mediated proliferation of skeletal muscle satellite cells [PMC7358459]. Chi-mir-150 is also one of the key miRNAs in profile 19, along with chi-miR-361-3p, chi-miR-193b-5p, chi-miR-193b-3p, and chi-miR-193a [PMC7358459]. The expression of chi-mir-150 has been validated through qRT-PCR and RNA-seq analysis [PMC7358459]. The targeted genes of chi-mir-150 are involved in cytoskeleton organization and include GDF7, LOC102169433, and VSIG10 [PMC7358459]. Additionally, SLIT1 is targeted by chi-mir-150 and plays a role in the directional migration and differentiation of pioneer myoblasts [PMC7358459]. Chi-mir-150 is also identified as one of six miRNAs along with chi-miR1515p, chi-miR196a/b, chi-miR30b5p, and chi-miR95p [PMC7318507]. It has been found to be involved in brown adipose-related processes along with other miRNAs such as chi-miR328 and the miR30 family [PMC8150810]. Furthermore, circ279_3 derived from Spice1 gene can sponge important adipogenesis-related miRNAs such as 1403p, 146b3p, and mir150 [PMC8150810].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UCUCCCAACCCUUGUACCAGUG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 28 other species

  1. Alligator mississippiensis ami-miR-150-5p
  2. Anolis carolinensis aca-miR-150-5p
  3. Bos taurus (cattle) Bta-Mir-150_5p (mature (guide))
  4. Callithrix jacchus cja-miR-150
  5. Callorhinchus milii Cmi-Mir-150_5p (mature (guide))
  6. Canis lupus familiaris cfa-miR-150
  7. Cavia porcellus cpo-miR-150-5p
  8. Cervus elaphus (red deer) cel-miR-150
  9. Cricetulus griseus (Chinese hamster) cgr-miR-150
  10. Dasypus novemcinctus (nine-banded armadillo) dno-miR-150-5p
  11. Echinops telfairi Ete-Mir-150_5p (mature (guide))
  12. Equus caballus (horse) eca-miR-150
  13. Gekko japonicus Gja-Mir-150_5p (mature (guide))
  14. Gorilla gorilla gorilla ggo-miR-150 (MIR150)
  15. Gorilla gorilla ggo-miR-150
  16. Homo sapiens (human) hsa-miR-150-5p
  17. Macaca mulatta (Rhesus monkey) mml-miR-150-5p
  18. Microcaecilia unicolor Mun-Mir-150_5p (mature (guide))
  19. Mus musculus (house mouse) mmu-miR-150-5p
  20. Ovis aries oar-miR-150
  21. Pan troglodytes ptr-miR-150
  22. Pongo pygmaeus ppy-miR-150
  23. Python bivittatus pbv-miR-150-5p
  24. Rattus norvegicus rno-miR-150-5p
  25. Scyliorhinus torazame (cloudy catshark) Sto-Mir-150_5p (mature (guide))
  26. Sphenodon punctatus (tuatara) Spt-Mir-150_5p (mature (guide))
  27. Sus scrofa ssc-miR-150
  28. Tursiops truncatus miR-150
Publications