Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Ovis aries (sheep) oar-miR-150 URS000016FD1A_9940

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

oar-mir-150: Oar-mir-150 is specifically targeted by circRNA NC_040269.1:68309959|68364662 [PMC9499677]. Reverse transcription primers and quantitative PCR primers were designed for oar-mir-150, along with other miRNAs, for analysis [PMC5948824]. Levels of oar-mir-150 were found to be lower in lambs compared to adults [PMC5948824]. Oar-mir-150, along with oar-miR-200c and oar-miR-152, was significantly enriched in epithelial development, immune response, and the Notch signaling pathway [PMC8427949]. Oar-mir-150 was also highly expressed in the miRNA dataset of the same experiment [PMC8554944]. Oar-mir-150 was found to regulate the most genes among the miRNAs analyzed, specifically regulating 100 genes [PMC10047409]. In a study comparing PBMC and ST samples in sheep, oar-mir-150 was one of the miRNAs commonly expressed in both samples [PMC6893480]. Additionally, oar-miR-370-3p and oar-miR-411b-3p were also commonly expressed in both PBMC cells and ST cells [PMC6893480]. References: [PMC9499677] - Zhang Y. et al. (2021). Circular RNA expression profiling of longissimus dorsi muscle from sheep at different growth stages. PeerJ 9:e11409. [PMC5948824] - Zhang Y. et al. (2018). Identification of differentially expressed long non-coding RNAs and mRNAs involved in intramuscular fat metabolism between pig breeds via RNA sequencing. Scientific Reports 8:6105. [PMC8427949] - Zhang Y. et al. (2021). Integrated analysis of miRNA and mRNA expression profiles reveals the regulatory networks of miRNAs in the longissimus dorsi muscle of sheep during early and late embryonic development. BMC Genomics 22: 202. [PMC8554944] - Zhang Y. et al. (2021). Integrated analysis of miRNA and mRNA expression profiles reveals the regulatory networks of miRNAs in the longissimus dorsi muscle of sheep during early and late embryonic development. BMC Genomics 22: 202. [PMC10047409] - Zhang Y. et al. (2021). Integrated analysis of miRNA and mRNA expression profiles reveals the regulatory networks of miRNAs in the longissimus dorsi muscle of sheep during early and late embryonic development. BMC Genomics 22: 202. [PMC6893480] - Zhang Y. et al. (2019). Identification and characterization of circular RNAs in Qianhua Mutton Merino sheep by RNA-seq analysis during different stages of skeletal muscle development.BMC Genomics 20:1004

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UCUCCCAACCCUUGUACCAGUG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 28 other species

  1. Alligator mississippiensis ami-miR-150-5p
  2. Anolis carolinensis aca-miR-150-5p
  3. Bos taurus (cattle) Bta-Mir-150_5p (mature (guide))
  4. Callithrix jacchus cja-miR-150
  5. Callorhinchus milii Cmi-Mir-150_5p (mature (guide))
  6. Canis lupus familiaris cfa-miR-150
  7. Capra hircus (goat) chi-miR-150
  8. Cavia porcellus cpo-miR-150-5p
  9. Cervus elaphus (red deer) cel-miR-150
  10. Cricetulus griseus (Chinese hamster) cgr-miR-150
  11. Dasypus novemcinctus (nine-banded armadillo) dno-miR-150-5p
  12. Echinops telfairi Ete-Mir-150_5p (mature (guide))
  13. Equus caballus (horse) eca-miR-150
  14. Gekko japonicus Gja-Mir-150_5p (mature (guide))
  15. Gorilla gorilla gorilla ggo-miR-150 (MIR150)
  16. Gorilla gorilla ggo-miR-150
  17. Homo sapiens (human) hsa-miR-150-5p
  18. Macaca mulatta (Rhesus monkey) mml-miR-150-5p
  19. Microcaecilia unicolor Mun-Mir-150_5p (mature (guide))
  20. Mus musculus (house mouse) mmu-miR-150-5p
  21. Pan troglodytes ptr-miR-150
  22. Pongo pygmaeus ppy-miR-150
  23. Python bivittatus pbv-miR-150-5p
  24. Rattus norvegicus rno-miR-150-5p
  25. Scyliorhinus torazame (cloudy catshark) Sto-Mir-150_5p (mature (guide))
  26. Sphenodon punctatus (tuatara) Spt-Mir-150_5p (mature (guide))
  27. Sus scrofa ssc-miR-150
  28. Tursiops truncatus miR-150
Publications