Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Callithrix jacchus (white-tufted-ear marmoset) cja-miR-150 URS000016FD1A_9483

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UCUCCCAACCCUUGUACCAGUG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 28 other species

  1. Alligator mississippiensis ami-miR-150-5p
  2. Anolis carolinensis aca-miR-150-5p
  3. Bos taurus (cattle) Bta-Mir-150_5p (mature (guide))
  4. Callorhinchus milii Cmi-Mir-150_5p (mature (guide))
  5. Canis lupus familiaris cfa-miR-150
  6. Capra hircus (goat) chi-miR-150
  7. Cavia porcellus cpo-miR-150-5p
  8. Cervus elaphus (red deer) cel-miR-150
  9. Cricetulus griseus (Chinese hamster) cgr-miR-150
  10. Dasypus novemcinctus (nine-banded armadillo) dno-miR-150-5p
  11. Echinops telfairi Ete-Mir-150_5p (mature (guide))
  12. Equus caballus (horse) eca-miR-150
  13. Gekko japonicus Gja-Mir-150_5p (mature (guide))
  14. Gorilla gorilla gorilla ggo-miR-150 (MIR150)
  15. Gorilla gorilla ggo-miR-150
  16. Homo sapiens (human) hsa-miR-150-5p
  17. Macaca mulatta (Rhesus monkey) mml-miR-150-5p
  18. Microcaecilia unicolor Mun-Mir-150_5p (mature (guide))
  19. Mus musculus (house mouse) mmu-miR-150-5p
  20. Ovis aries oar-miR-150
  21. Pan troglodytes ptr-miR-150
  22. Pongo pygmaeus ppy-miR-150
  23. Python bivittatus pbv-miR-150-5p
  24. Rattus norvegicus rno-miR-150-5p
  25. Scyliorhinus torazame (cloudy catshark) Sto-Mir-150_5p (mature (guide))
  26. Sphenodon punctatus (tuatara) Spt-Mir-150_5p (mature (guide))
  27. Sus scrofa ssc-miR-150
  28. Tursiops truncatus miR-150