Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Mus musculus (house mouse) mmu-miR-22-3p URS0000096022_10090

Automated summary: This miRNA sequence is 22 nucleotides long and is found in Mus musculus. Annotated by 7 databases (RefSeq, miRBase, PirBase, ENA, TarBase, MirGeneDB, LncBase). Described in 43 papers. Mus musculus (house mouse) mmu-miR-22-3p sequence is a product of miR-22, mmu-miR-22, Mir22, 22, miR-22-3p, mmu-miR-22-3p genes. Interacts with lncRNAs, such as (). Interacts with protein-coding genes, including -14 gene, 0610007H07Rik, 0610007M19Rik, 0610008C09Rik, 0610009F02Rik, 0610009H04Rik, 0610009I22Rik, 0610009O03Rik, 0610010C24Rik, 0610010I05Rik.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    AAGCUGCCAGUUGAAGAACUGU

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 42 other species

    1. Anolis carolinensis (green anole) Aca-Mir-22-P1a_3p (mature (guide))
    2. Artibeus jamaicensis aja-miR-22
    3. Ateles geoffroyi age-miR-22
    4. Bos taurus (cattle) Bta-Mir-22-P1a_3p (mature (guide))
    5. Callithrix jacchus (white-tufted-ear marmoset) cja-miR-22
    6. Callorhinchus milii eshark_mir-22_1
    7. Canis lupus familiaris cfa-miR-22
    8. Cavia porcellus (domestic guinea pig) cpo-miR-22-3p
    9. Cervus elaphus cel-miR-22-3p
    10. Chrysemys picta bellii Cpi-Mir-22-P1a_3p (mature (co-guide))
    11. Chrysemys picta cpi-miR-22-3p
    12. Columba livia cli-miR-22-3p
    13. Cricetulus griseus cgr-miR-22-3p
    14. Dasypus novemcinctus dno-miR-22-3p
    15. Daubentonia madagascariensis dma-miR-22
    16. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-22-P1a_3p (mature (guide))
    17. Equus caballus eca-miR-22
    18. Gallus gallus (chicken) gga-miR-22-3p
    19. Homo sapiens hsa-miR-22-3p
    20. Lagothrix lagotricha lla-miR-22
    21. Lemur catta (Ring-tailed lemur) lca-miR-22
    22. Macaca mulatta mml-miR-22
    23. Macaca nemestrina mne-miR-22
    24. Microcebus murinus (gray mouse lemur) mmr-miR-22
    25. Nomascus leucogenys (northern white-cheeked gibbon) nle-miR-22
    26. Ophiophagus hannah oha-miR-22a
    27. Ornithorhynchus anatinus oan-miR-22-3p
    28. Oryctolagus cuniculus ocu-miR-22-3p
    29. Otolemur garnettii oga-miR-22
    30. Pan paniscus (pygmy chimpanzee) ppa-miR-22
    31. Pan troglodytes ptr-miR-22
    32. Papio hamadryas pha-miR-22
    33. Pongo pygmaeus ppy-miR-22
    34. Pteropus alecto (black flying fox) pal-miR-22-3p
    35. Python bivittatus (Burmese python) pbv-miR-22-3p
    36. Rattus norvegicus (Norway rat) rno-miR-22-3p
    37. Saguinus labiatus (red-chested mustached tamarin) sla-miR-22
    38. Saimiri boliviensis boliviensis (Bolivian squirrel monkey) sbo-miR-22
    39. Scyliorhinus torazame (cloudy catshark) Sto-Mir-22-P1a_3p (mature (guide))
    40. Sus scrofa (pig) ssc-miR-22-3p
    41. Tupaia chinensis tch-miR-22-3p
    42. Xenopus laevis xla-miR-22
    43. Xenopus tropicalis (tropical clawed frog) xtr-miR-22-3p