Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Gallus gallus (chicken) gga-miR-22-3p URS0000096022_9031

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

gga-mir-22: Gga-mir-22 is a microRNA that has been found to be significantly increased upon CD40L-stimulation [PMC3743212]. It is also expressed at high levels in HD11 cells [PMC3743212]. Gga-mir-22 has been shown to be differentially expressed in various infection models, including avian influenza virus infection in chicken lungs [PMC5389138], swine-origin H1N1 or avian-origin H7N7 influenza A virus infection in A549 cells [PMC5389138], and highly pathogenic H5N1 avian virus infection in cynomolgus macaques [PMC5389138]. Gga-mir-22 has also been linked to lipid metabolic genes, such as ACSL5, ELVOL6, and PLIN2, suggesting a role in regulating hepatic lipid production during egg production in chickens [PMC7936154]. In addition, gga-mir-22 has been highlighted as being differentially expressed in infected dendritic cells and showed higher expression levels in line 61 compared to line 72 birds after MDV infection [PMC9698451]. The higher expression of gga-mir-22 in line 61 birds may have a protective role against some of the symptoms associated with MDV infection [PMC9698451]. Overall, gga-mir-22 appears to play a role in immune response and lipid metabolism regulation.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AAGCUGCCAGUUGAAGAACUGU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 100 other species

  1. Alligator mississippiensis Ami-Mir-22-P1b_3p (mature (guide))
  2. Anolis carolinensis Aca-Mir-22-P1b_3p (mature (guide))
  3. Artibeus jamaicensis aja-miR-22
  4. Ateles geoffroyi (black-handed spider monkey) age-miR-22
  5. Bos taurus Bta-Mir-22-P1b_3p (mature (guide))
  6. Callithrix jacchus (white-tufted-ear marmoset) cja-miR-22
  7. Callorhinchus milii Cmi-Mir-22-P1b_3p (mature (guide))
  8. Canis lupus familiaris cfa-miR-22
  9. Cavia porcellus cpo-miR-22-3p
  10. Cervus elaphus cel-miR-22-3p
  11. Chrysemys picta bellii Cpi-Mir-22-P1b_3p (mature (guide))
  12. Chrysemys picta cpi-miR-22-3p
  13. Columba livia cli-miR-22-3p
  14. Cricetulus griseus (Chinese hamster) cgr-miR-22-3p
  15. Dasypus novemcinctus (nine-banded armadillo) dno-miR-22-3p
  16. Daubentonia madagascariensis (aye-aye) dma-miR-22
  17. Echinops telfairi Ete-Mir-22-P1b_3p (mature (guide))
  18. Equus caballus (horse) eca-miR-22
  19. Gekko japonicus Gja-Mir-22-P1b_3p (mature (guide))
  20. Homo sapiens (human) hsa-miR-22-3p
  21. Lagothrix lagotricha lla-miR-22
  22. Latimeria chalumnae Lch-Mir-22-P1b_3p (mature (guide))
  23. Lemur catta (Ring-tailed lemur) lca-miR-22
  24. Lepisosteus oculatus (spotted gar) Loc-Mir-22-P1b_3p (mature (guide))
  25. Macaca mulatta (Rhesus monkey) mml-miR-22
  26. Macaca nemestrina (pig-tailed macaque) mne-miR-22
  27. Microcaecilia unicolor Mun-Mir-22-P1b_3p (mature (guide))
  28. Microcebus murinus (gray mouse lemur) mmr-miR-22
  29. Mus musculus mmu-miR-22-3p
  30. Nomascus leucogenys (northern white-cheeked gibbon) nle-miR-22
  31. Ophiophagus hannah oha-miR-22a
  32. Ornithorhynchus anatinus (platypus) oan-miR-22-3p
  33. Oryctolagus cuniculus ocu-miR-22-3p
  34. Otolemur garnettii oga-miR-22
  35. Pan paniscus ppa-miR-22
  36. Pan troglodytes ptr-miR-22
  37. Papio hamadryas (hamadryas baboon) pha-miR-22
  38. Pongo pygmaeus (Bornean orangutan) ppy-miR-22
  39. Pteropus alecto (black flying fox) pal-miR-22-3p
  40. Python bivittatus pbv-miR-22-3p
  41. Rattus norvegicus rno-miR-22-3p
  42. Saguinus labiatus sla-miR-22
  43. Saimiri boliviensis boliviensis sbo-miR-22
  44. Scyliorhinus torazame Sto-Mir-22-P1b_3p (mature (guide))
  45. Sphenodon punctatus (tuatara) Spt-Mir-22-P1b_3p (mature (guide))
  46. Sus scrofa ssc-miR-22-3p
  47. Taeniopygia guttata Tgu-Mir-22-P1b_3p (mature (guide))
  48. Tupaia chinensis tch-miR-22-3p
  49. Xenopus laevis (African clawed frog) Xla-Mir-22-P1b4_3p (mature (co-guide))
  50. Xenopus tropicalis (tropical clawed frog) xtr-miR-22-3p
Publications