Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Gallus gallus (chicken) gga-miR-22-3p URS0000096022_9031

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

gga-mir-22: gga-mir-22 is a microRNA that is significantly upregulated upon CD40L-stimulation in chicken cells, as indicated by its inclusion in a group of miRNAs with increased expression levels [PMC3743212]. It is also expressed at high levels in HD11 cells, accounting for 3.4% of the miRNA expression profile [PMC3743212]. In the context of avian influenza virus infection, gga-mir-22 is differentially expressed in chicken lung and trachea, suggesting its involvement in the host response to viral infections [PMC5389138]. Furthermore, gga-mir-22 has been implicated in the regulation of lipid metabolism genes such as ACSL5, ELOVL6, and PLIN2 and is thought to play a role in regulating hepatic lipid production during egg production in chickens [PMC7936154]. In studies focusing on Marek's disease virus (MDV), which affects the nervous system of chickens, gga-mir-22 showed higher expression levels in line 61 birds that may confer some protection against MDV symptoms [PMC9698451]. Additionally, after MDV infection, gga-mir-22 demonstrated greater expression associated with a more resistant phenotype compared to other miRNAs like gga-mir-3064 and gga-mir-6690 which were more highly expressed in susceptible birds [PMC9698451].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AAGCUGCCAGUUGAAGAACUGU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 52 other species

  1. Alligator mississippiensis (American alligator) Ami-Mir-22-P1b_3p (mature (guide))
  2. Anolis carolinensis Aca-Mir-22-P1b_3p (mature (guide))
  3. Artibeus jamaicensis aja-miR-22
  4. Ateles geoffroyi age-miR-22
  5. Bos taurus (domestic cattle) Bta-Mir-22-P1b_3p (mature (guide))
  6. Callithrix jacchus cja-miR-22
  7. Callorhinchus milii (elephant shark) Cmi-Mir-22-P1b_3p (mature (guide))
  8. Canis lupus familiaris cfa-miR-22
  9. Cavia porcellus (domestic guinea pig) cpo-miR-22-3p
  10. Cervus elaphus (red deer) cel-miR-22-3p
  11. Chrysemys picta bellii (western painted turtle) Cpi-Mir-22-P1b_3p (mature (guide))
  12. Chrysemys picta (Painted turtle) cpi-miR-22-3p
  13. Columba livia cli-miR-22-3p
  14. Cricetulus griseus (Chinese hamster) cgr-miR-22-3p
  15. Dasypus novemcinctus dno-miR-22-3p
  16. Daubentonia madagascariensis (aye-aye) dma-miR-22
  17. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-22-P1b_3p (mature (guide))
  18. Equus caballus (horse) eca-miR-22
  19. Gekko japonicus Gja-Mir-22-P1b_3p (mature (guide))
  20. Homo sapiens hsa-miR-22-3p
  21. Lagothrix lagotricha (brown woolly monkey) lla-miR-22
  22. Latimeria chalumnae (coelacanth) Lch-Mir-22-P1b_3p (mature (guide))
  23. Lemur catta (Ring-tailed lemur) lca-miR-22
  24. Lepisosteus oculatus (spotted gar) Loc-Mir-22-P1b_3p (mature (guide))
  25. Loxodonta africana (African savanna elephant) Laf-Mir-22-P1b_3p (mature (guide))
  26. Macaca mulatta (Rhesus monkey) mml-miR-22
  27. Macaca nemestrina (pig-tailed macaque) mne-miR-22
  28. Microcaecilia unicolor Mun-Mir-22-P1b_3p (mature (guide))
  29. Microcebus murinus (gray mouse lemur) mmr-miR-22
  30. Mus musculus mmu-miR-22-3p
  31. Nomascus leucogenys (northern white-cheeked gibbon) nle-miR-22
  32. Ophiophagus hannah oha-miR-22a
  33. Ornithorhynchus anatinus (platypus) oan-miR-22-3p
  34. Oryctolagus cuniculus ocu-miR-22-3p
  35. Otolemur garnettii oga-miR-22
  36. Pan paniscus (pygmy chimpanzee) ppa-miR-22
  37. Pan troglodytes ptr-miR-22
  38. Papio hamadryas (hamadryas baboon) pha-miR-22
  39. Pongo abelii (Sumatran orangutan) Pab-Mir-22-P1b_3p (mature (guide))
  40. Pongo pygmaeus (Bornean orangutan) ppy-miR-22
  41. Pteropus alecto (black flying fox) pal-miR-22-3p
  42. Python bivittatus (Burmese python) pbv-miR-22-3p
  43. Rattus norvegicus (Norway rat) rno-miR-22-3p
  44. Saguinus labiatus (red-chested mustached tamarin) sla-miR-22
  45. Saimiri boliviensis boliviensis sbo-miR-22
  46. Scyliorhinus torazame (cloudy catshark) Sto-Mir-22-P1b_3p (mature (guide))
  47. Sphenodon punctatus (tuatara) Spt-Mir-22-P1b_3p (mature (guide))
  48. Sus scrofa ssc-miR-22-3p
  49. Taeniopygia guttata (zebra finch) Tgu-Mir-22-P1b_3p (mature (guide))
  50. Tupaia chinensis (Chinese tree shrew) tch-miR-22-3p
  51. Xenopus laevis (African clawed frog) Xla-Mir-22-P1b4_3p (mature (co-guide))
  52. Xenopus tropicalis (tropical clawed frog) xtr-miR-22-3p
Relationships

Molecular Relationships

Publications