Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Mus musculus (house mouse) mmu-miR-22-3p URS0000096022_10090

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

mmu-mir-22: Mmu-mir-22 is a microRNA that is predicted to regulate the gene Arfip2 [PMC3753644]. Co-transfection experiments with synthetic mmu-mir-22 were performed to evaluate its effect on luciferase protein activity [PMC3753644]. Mmu-mir-22 was found to reduce luciferase activity, along with mmu-miR-26a, and their combination had the greatest effect [PMC3753644]. Mmu-mir-22 was also found to regulate targets such as Wasf1, Arpc5, and Nr3c1, which are involved in C2C12 cell differentiation [PMC3753644]. Similar to mmu-miR-133a and mmu-miR-26a, mmu-mir-22 is upregulated during differentiation of C2C12 cells [PMC3753644]. Mmu-mir-22 has predicted binding sites in the 3' UTR of Fbxl19 [PMC3753644]. In a study on antipsychotic drug treatment, mmu-mir-22 was found to be significantly downregulated in the haloperidol treatment group [PMC3622003]. Mmu-mir-22 has also been predicted to target ion channel proteins such as Ank3 and Trpm7 [PMC4668358]. The expression of mmu-mir-22 was found to be upregulated after UVB irradiation in mice [PMC3597329]. Knockout mouse tissues for mmu-mir-22 were obtained for further study [PMC4869178]. The TRE-MiR-22 mouse model was generated by amplifying the coding sequence of mmu-MIR 2 from mouse genomic DNA and cloning it into a plasmid construct [PMC4447420].

mRNA interactions 4 total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AAGCUGCCAGUUGAAGAACUGU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 50 other species

  1. Alligator mississippiensis Ami-Mir-22-P1b_3p (mature (guide))
  2. Anolis carolinensis (green anole) Aca-Mir-22-P1b_3p (mature (guide))
  3. Artibeus jamaicensis (Jamaican fruit-eating bat) aja-miR-22
  4. Ateles geoffroyi (black-handed spider monkey) age-miR-22
  5. Bos taurus Bta-Mir-22-P1b_3p (mature (guide))
  6. Callithrix jacchus (white-tufted-ear marmoset) cja-miR-22
  7. Callorhinchus milii Cmi-Mir-22-P1b_3p (mature (guide))
  8. Canis lupus familiaris (dog) cfa-miR-22
  9. Cavia porcellus cpo-miR-22-3p
  10. Cervus elaphus cel-miR-22-3p
  11. Chrysemys picta bellii (western painted turtle) Cpi-Mir-22-P1b_3p (mature (guide))
  12. Chrysemys picta cpi-miR-22-3p
  13. Columba livia cli-miR-22-3p
  14. Cricetulus griseus (Chinese hamster) cgr-miR-22-3p
  15. Dasypus novemcinctus dno-miR-22-3p
  16. Daubentonia madagascariensis (aye-aye) dma-miR-22
  17. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-22-P1b_3p (mature (guide))
  18. Equus caballus (horse) eca-miR-22
  19. Gallus gallus gga-miR-22-3p
  20. Gekko japonicus Gja-Mir-22-P1b_3p (mature (guide))
  21. Homo sapiens (human) hsa-miR-22-3p
  22. Lagothrix lagotricha (brown woolly monkey) lla-miR-22
  23. Latimeria chalumnae Lch-Mir-22-P1b_3p (mature (guide))
  24. Lemur catta (Ring-tailed lemur) lca-miR-22
  25. Lepisosteus oculatus Loc-Mir-22-P1b_3p (mature (guide))
  26. Macaca mulatta mml-miR-22
  27. Macaca nemestrina (pig-tailed macaque) mne-miR-22
  28. Microcaecilia unicolor Mun-Mir-22-P1b_3p (mature (guide))
  29. Microcebus murinus (gray mouse lemur) mmr-miR-22
  30. Nomascus leucogenys nle-miR-22
  31. Ophiophagus hannah (king cobra) oha-miR-22a
  32. Ornithorhynchus anatinus (platypus) oan-miR-22-3p
  33. Oryctolagus cuniculus (rabbit) ocu-miR-22-3p
  34. Otolemur garnettii (small-eared galago) oga-miR-22
  35. Pan paniscus (pygmy chimpanzee) ppa-miR-22
  36. Pan troglodytes (chimpanzee) ptr-miR-22
  37. Papio hamadryas pha-miR-22
  38. Pongo pygmaeus ppy-miR-22
  39. Pteropus alecto pal-miR-22-3p
  40. Python bivittatus pbv-miR-22-3p
  41. Rattus norvegicus (Norway rat) rno-miR-22-3p
  42. Saguinus labiatus (red-chested mustached tamarin) sla-miR-22
  43. Saimiri boliviensis boliviensis (Bolivian squirrel monkey) sbo-miR-22
  44. Scyliorhinus torazame Sto-Mir-22-P1b_3p (mature (guide))
  45. Sphenodon punctatus (tuatara) Spt-Mir-22-P1b_3p (mature (guide))
  46. Sus scrofa (pig) ssc-miR-22-3p
  47. Taeniopygia guttata (zebra finch) Tgu-Mir-22-P1b_3p (mature (guide))
  48. Tupaia chinensis tch-miR-22-3p
  49. Xenopus laevis Xla-Mir-22-P1b4_3p (mature (co-guide))
  50. Xenopus tropicalis xtr-miR-22-3p
Publications