Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Pongo pygmaeus (Bornean orangutan) ppy-miR-22 URS0000096022_9600

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AAGCUGCCAGUUGAAGAACUGU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 52 other species

  1. Alligator mississippiensis (American alligator) Ami-Mir-22-P1b_3p (mature (guide))
  2. Anolis carolinensis Aca-Mir-22-P1b_3p (mature (guide))
  3. Artibeus jamaicensis aja-miR-22
  4. Ateles geoffroyi age-miR-22
  5. Bos taurus (domestic cattle) Bta-Mir-22-P1b_3p (mature (guide))
  6. Callithrix jacchus cja-miR-22
  7. Callorhinchus milii (elephant shark) Cmi-Mir-22-P1b_3p (mature (guide))
  8. Canis lupus familiaris cfa-miR-22
  9. Cavia porcellus (domestic guinea pig) cpo-miR-22-3p
  10. Cervus elaphus (red deer) cel-miR-22-3p
  11. Chrysemys picta bellii (western painted turtle) Cpi-Mir-22-P1b_3p (mature (guide))
  12. Chrysemys picta (Painted turtle) cpi-miR-22-3p
  13. Columba livia cli-miR-22-3p
  14. Cricetulus griseus (Chinese hamster) cgr-miR-22-3p
  15. Dasypus novemcinctus dno-miR-22-3p
  16. Daubentonia madagascariensis (aye-aye) dma-miR-22
  17. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-22-P1b_3p (mature (guide))
  18. Equus caballus (horse) eca-miR-22
  19. Gallus gallus gga-miR-22-3p
  20. Gekko japonicus Gja-Mir-22-P1b_3p (mature (guide))
  21. Homo sapiens hsa-miR-22-3p
  22. Lagothrix lagotricha (brown woolly monkey) lla-miR-22
  23. Latimeria chalumnae (coelacanth) Lch-Mir-22-P1b_3p (mature (guide))
  24. Lemur catta (Ring-tailed lemur) lca-miR-22
  25. Lepisosteus oculatus (spotted gar) Loc-Mir-22-P1b_3p (mature (guide))
  26. Loxodonta africana (African savanna elephant) Laf-Mir-22-P1b_3p (mature (guide))
  27. Macaca mulatta (Rhesus monkey) mml-miR-22
  28. Macaca nemestrina (pig-tailed macaque) mne-miR-22
  29. Microcaecilia unicolor Mun-Mir-22-P1b_3p (mature (guide))
  30. Microcebus murinus (gray mouse lemur) mmr-miR-22
  31. Mus musculus mmu-miR-22-3p
  32. Nomascus leucogenys (northern white-cheeked gibbon) nle-miR-22
  33. Ophiophagus hannah oha-miR-22a
  34. Ornithorhynchus anatinus (platypus) oan-miR-22-3p
  35. Oryctolagus cuniculus ocu-miR-22-3p
  36. Otolemur garnettii oga-miR-22
  37. Pan paniscus (pygmy chimpanzee) ppa-miR-22
  38. Pan troglodytes ptr-miR-22
  39. Papio hamadryas (hamadryas baboon) pha-miR-22
  40. Pongo abelii (Sumatran orangutan) Pab-Mir-22-P1b_3p (mature (guide))
  41. Pteropus alecto (black flying fox) pal-miR-22-3p
  42. Python bivittatus (Burmese python) pbv-miR-22-3p
  43. Rattus norvegicus (Norway rat) rno-miR-22-3p
  44. Saguinus labiatus (red-chested mustached tamarin) sla-miR-22
  45. Saimiri boliviensis boliviensis sbo-miR-22
  46. Scyliorhinus torazame (cloudy catshark) Sto-Mir-22-P1b_3p (mature (guide))
  47. Sphenodon punctatus (tuatara) Spt-Mir-22-P1b_3p (mature (guide))
  48. Sus scrofa ssc-miR-22-3p
  49. Taeniopygia guttata (zebra finch) Tgu-Mir-22-P1b_3p (mature (guide))
  50. Tupaia chinensis (Chinese tree shrew) tch-miR-22-3p
  51. Xenopus laevis (African clawed frog) Xla-Mir-22-P1b4_3p (mature (co-guide))
  52. Xenopus tropicalis (tropical clawed frog) xtr-miR-22-3p
Relationships

Molecular Relationships